Incidental Mutation 'R9248:Ttc41'
ID 701372
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms Gnn, BC030307
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R9248 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 86705811-86776844 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 86731249 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 593 (L593Q)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075632] [ENSMUST00000219108]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000075632
AA Change: L593Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: L593Q

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219108
AA Change: L593Q

PolyPhen 2 Score 0.384 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T C 9: 119,153,934 N132S probably benign Het
Agpat2 A G 2: 26,593,589 *279Q probably null Het
Akr1c19 C A 13: 4,242,975 D243E probably benign Het
Alg2 A G 4: 47,474,001 F96L probably benign Het
Apob C T 12: 8,015,231 Q4067* probably null Het
C8a T C 4: 104,846,002 Y330C probably damaging Het
Ccdc185 A G 1: 182,748,656 V156A probably benign Het
Ces1g A G 8: 93,333,691 L100P possibly damaging Het
Cnbd1 T C 4: 18,862,113 N359S possibly damaging Het
Crybb2 C T 5: 113,063,228 A65T probably benign Het
Dcaf5 T C 12: 80,339,789 D521G probably benign Het
Dnmt1 A G 9: 20,922,112 F631L possibly damaging Het
Dok1 T A 6: 83,031,912 D263V possibly damaging Het
Ecel1 A G 1: 87,153,390 F293L probably benign Het
Ehmt1 A T 2: 24,848,065 L509Q possibly damaging Het
Fbln2 T A 6: 91,254,574 V551E possibly damaging Het
Fig4 C T 10: 41,277,482 V108I probably benign Het
Gpa33 A G 1: 166,163,827 Y209C probably damaging Het
Heatr5a T C 12: 51,916,243 H52R Het
Heatr9 A T 11: 83,518,455 D157E possibly damaging Het
Jakmip2 A C 18: 43,552,177 M682R probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Layn A G 9: 51,057,460 S328P possibly damaging Het
Mblac2 A G 13: 81,711,650 D41G probably damaging Het
Mboat1 A G 13: 30,226,409 Y283C probably damaging Het
Mdga2 A G 12: 66,689,452 V334A possibly damaging Het
Mroh4 C T 15: 74,613,318 R515H possibly damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nsrp1 G A 11: 77,046,210 R387W probably benign Het
Olfr483 T C 7: 108,104,049 S247P probably damaging Het
Olfr894 T C 9: 38,219,410 Y193H probably benign Het
Ostm1 T C 10: 42,698,214 V301A probably damaging Het
Pcdhb13 A T 18: 37,444,555 D662V probably damaging Het
Pfpl T A 19: 12,429,010 S208R probably damaging Het
Plin5 A T 17: 56,112,324 V366E probably damaging Het
Rmi1 A G 13: 58,409,085 I383V probably benign Het
Rnh1 T C 7: 141,160,801 T414A probably benign Het
Sash1 C A 10: 8,741,532 G537W probably damaging Het
Slc9c1 A G 16: 45,550,188 N264S probably benign Het
Speg A C 1: 75,421,776 T1956P probably damaging Het
St14 T C 9: 31,091,609 Y666C probably damaging Het
Stab2 T A 10: 86,891,617 H1448L probably damaging Het
Taf9 T A 13: 100,654,352 probably benign Het
Thumpd2 G A 17: 81,026,611 A516V possibly damaging Het
Tmem132e A G 11: 82,444,482 K797E probably damaging Het
Tpte A G 8: 22,351,473 T494A possibly damaging Het
Uggt1 A C 1: 36,210,022 I279S possibly damaging Het
Uxs1 A G 1: 43,764,924 F277S probably damaging Het
Vat1 A T 11: 101,460,554 N320K possibly damaging Het
Wdr81 G T 11: 75,445,430 A592E Het
Zfp780b C T 7: 27,973,718 probably null Het
Zfp944 A T 17: 22,343,638 probably null Het
Zfp956 G T 6: 47,957,503 G136W possibly damaging Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86736933 missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86775957 missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86776678 missense probably benign
IGL01707:Ttc41 APN 10 86776767 missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86731026 missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86776624 missense probably benign 0.03
IGL01918:Ttc41 APN 10 86713190 missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86775951 missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86760914 nonsense probably null
IGL02887:Ttc41 APN 10 86733654 missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86736857 missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86758348 missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86724414 critical splice donor site probably null
IGL03242:Ttc41 APN 10 86776819 makesense probably null
IGL03307:Ttc41 APN 10 86744440 missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86776047 missense probably benign 0.10
BB013:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0379:Ttc41 UTSW 10 86712977 missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86763947 missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86759097 missense probably benign 0.00
R1589:Ttc41 UTSW 10 86776390 missense probably benign 0.01
R1599:Ttc41 UTSW 10 86776573 missense probably benign 0.04
R1608:Ttc41 UTSW 10 86775993 missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86776252 missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86776214 missense probably benign
R2398:Ttc41 UTSW 10 86713386 missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86724374 missense probably benign 0.42
R3117:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86729798 missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4841:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4842:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4884:Ttc41 UTSW 10 86731018 missense probably benign 0.00
R4885:Ttc41 UTSW 10 86759102 missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86776192 missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86744544 missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86730942 missense probably benign 0.13
R5268:Ttc41 UTSW 10 86744478 missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86776579 missense probably benign 0.04
R5301:Ttc41 UTSW 10 86719520 missense probably benign 0.00
R5425:Ttc41 UTSW 10 86776630 missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86760920 critical splice donor site probably null
R5635:Ttc41 UTSW 10 86736977 missense probably benign 0.09
R5752:Ttc41 UTSW 10 86758346 missense probably benign 0.33
R5868:Ttc41 UTSW 10 86750264 missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86713224 missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86759088 critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86776663 missense probably benign 0.00
R6260:Ttc41 UTSW 10 86731159 missense probably benign 0.20
R6260:Ttc41 UTSW 10 86733707 missense probably benign 0.32
R6276:Ttc41 UTSW 10 86744449 missense probably benign 0.01
R6458:Ttc41 UTSW 10 86758270 missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86713503 missense probably benign 0.17
R7348:Ttc41 UTSW 10 86750348 nonsense probably null
R7382:Ttc41 UTSW 10 86776510 missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86713432 missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86759224 missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86776631 missense probably benign 0.02
R7926:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R7998:Ttc41 UTSW 10 86736847 missense probably benign 0.01
R8021:Ttc41 UTSW 10 86733714 missense probably benign
R8059:Ttc41 UTSW 10 86712978 missense probably benign 0.01
R8170:Ttc41 UTSW 10 86776166 missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86719630 missense probably benign 0.06
R8375:Ttc41 UTSW 10 86763980 missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86719526 missense probably benign 0.00
R8698:Ttc41 UTSW 10 86712977 missense probably benign 0.00
R8773:Ttc41 UTSW 10 86729815 missense probably benign 0.35
R8902:Ttc41 UTSW 10 86713001 missense probably benign 0.06
R8985:Ttc41 UTSW 10 86731092 missense possibly damaging 0.80
R8988:Ttc41 UTSW 10 86713735 missense possibly damaging 0.88
R9007:Ttc41 UTSW 10 86733761 missense probably damaging 1.00
R9137:Ttc41 UTSW 10 86776622 missense probably benign 0.22
R9236:Ttc41 UTSW 10 86776730 missense probably damaging 1.00
R9287:Ttc41 UTSW 10 86763966 missense probably benign 0.43
R9345:Ttc41 UTSW 10 86759225 missense probably damaging 0.99
R9386:Ttc41 UTSW 10 86713026 missense probably damaging 0.99
X0024:Ttc41 UTSW 10 86724250 missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86729797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGCTCGCAATCATCGCCAG -3'
(R):5'- GAGCTGTTACTAAACTGAGAAAGGTC -3'

Sequencing Primer
(F):5'- GCAATGAGTTCCAGTGTC -3'
(R):5'- TGAGTCCAGCCTGGTCTACATAAG -3'
Posted On 2022-03-25