Incidental Mutation 'R9248:Rmi1'
ID 701385
Institutional Source Beutler Lab
Gene Symbol Rmi1
Ensembl Gene ENSMUSG00000035367
Gene Name RecQ mediated genome instability 1
Synonyms 4932432N11Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.483) question?
Stock # R9248 (G1)
Quality Score 201.009
Status Not validated
Chromosome 13
Chromosomal Location 58550062-58558962 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58556899 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 383 (I383V)
Ref Sequence ENSEMBL: ENSMUSP00000041035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042450] [ENSMUST00000224479] [ENSMUST00000225815] [ENSMUST00000225828]
AlphaFold Q9D4G9
Predicted Effect probably benign
Transcript: ENSMUST00000042450
AA Change: I383V

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000041035
Gene: ENSMUSG00000035367
AA Change: I383V

DomainStartEndE-ValueType
DUF1767 11 104 1.62e-34 SMART
low complexity region 243 259 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
Pfam:RMI1_C 479 614 4.2e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224479
AA Change: I383V

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000225815
AA Change: I383V

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000225828
AA Change: I383V

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RMI1 is a component of protein complexes that limit DNA crossover formation via the dissolution of double Holliday junctions (Raynard et al., 2006 [PubMed 16595695]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased weight and increased resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T C 9: 118,983,002 (GRCm39) N132S probably benign Het
Agpat2 A G 2: 26,483,601 (GRCm39) *279Q probably null Het
Akr1c19 C A 13: 4,292,974 (GRCm39) D243E probably benign Het
Alg2 A G 4: 47,474,001 (GRCm39) F96L probably benign Het
Apob C T 12: 8,065,231 (GRCm39) Q4067* probably null Het
C1ra A T 6: 124,489,580 (GRCm39) probably benign Het
C8a T C 4: 104,703,199 (GRCm39) Y330C probably damaging Het
Ccdc185 A G 1: 182,576,221 (GRCm39) V156A probably benign Het
Ces1g A G 8: 94,060,319 (GRCm39) L100P possibly damaging Het
Cnbd1 T C 4: 18,862,113 (GRCm39) N359S possibly damaging Het
Crybb2 C T 5: 113,211,094 (GRCm39) A65T probably benign Het
Dcaf5 T C 12: 80,386,563 (GRCm39) D521G probably benign Het
Dnmt1 A G 9: 20,833,408 (GRCm39) F631L possibly damaging Het
Dok1 T A 6: 83,008,893 (GRCm39) D263V possibly damaging Het
Ecel1 A G 1: 87,081,112 (GRCm39) F293L probably benign Het
Ehmt1 A T 2: 24,738,077 (GRCm39) L509Q possibly damaging Het
Fbln2 T A 6: 91,231,556 (GRCm39) V551E possibly damaging Het
Fig4 C T 10: 41,153,478 (GRCm39) V108I probably benign Het
Gpa33 A G 1: 165,991,396 (GRCm39) Y209C probably damaging Het
Heatr5a T C 12: 51,963,026 (GRCm39) H52R Het
Heatr9 A T 11: 83,409,281 (GRCm39) D157E possibly damaging Het
Jakmip2 A C 18: 43,685,242 (GRCm39) M682R probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Layn A G 9: 50,968,760 (GRCm39) S328P possibly damaging Het
Mblac2 A G 13: 81,859,769 (GRCm39) D41G probably damaging Het
Mboat1 A G 13: 30,410,392 (GRCm39) Y283C probably damaging Het
Mdga2 A G 12: 66,736,226 (GRCm39) V334A possibly damaging Het
Mroh4 C T 15: 74,485,167 (GRCm39) R515H possibly damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nos1 G C 5: 118,017,402 (GRCm39) R255P probably benign Het
Nsrp1 G A 11: 76,937,036 (GRCm39) R387W probably benign Het
Or5p59 T C 7: 107,703,256 (GRCm39) S247P probably damaging Het
Or8c16 T C 9: 38,130,706 (GRCm39) Y193H probably benign Het
Ostm1 T C 10: 42,574,210 (GRCm39) V301A probably damaging Het
Pcdhb13 A T 18: 37,577,608 (GRCm39) D662V probably damaging Het
Pfpl T A 19: 12,406,374 (GRCm39) S208R probably damaging Het
Plin5 A T 17: 56,419,324 (GRCm39) V366E probably damaging Het
Rnh1 T C 7: 140,740,714 (GRCm39) T414A probably benign Het
Sash1 C A 10: 8,617,296 (GRCm39) G537W probably damaging Het
Slc9c1 A G 16: 45,370,551 (GRCm39) N264S probably benign Het
Speg A C 1: 75,398,420 (GRCm39) T1956P probably damaging Het
St14 T C 9: 31,002,905 (GRCm39) Y666C probably damaging Het
Stab2 T A 10: 86,727,481 (GRCm39) H1448L probably damaging Het
Syne2 C T 12: 76,154,230 (GRCm39) probably benign Het
Taf9 T A 13: 100,790,860 (GRCm39) probably benign Het
Thumpd2 G A 17: 81,334,040 (GRCm39) A516V possibly damaging Het
Tmem132e A G 11: 82,335,308 (GRCm39) K797E probably damaging Het
Tpte A G 8: 22,841,489 (GRCm39) T494A possibly damaging Het
Ttc41 T A 10: 86,567,113 (GRCm39) L593Q probably benign Het
Uggt1 A C 1: 36,249,103 (GRCm39) I279S possibly damaging Het
Uxs1 A G 1: 43,804,084 (GRCm39) F277S probably damaging Het
Vat1 A T 11: 101,351,380 (GRCm39) N320K possibly damaging Het
Wdr81 G T 11: 75,336,256 (GRCm39) A592E Het
Zfp780b C T 7: 27,673,143 (GRCm39) probably null Het
Zfp944 A T 17: 22,562,619 (GRCm39) probably null Het
Zfp956 G T 6: 47,934,437 (GRCm39) G136W possibly damaging Het
Other mutations in Rmi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Rmi1 APN 13 58,557,208 (GRCm39) missense probably damaging 1.00
IGL02304:Rmi1 APN 13 58,557,290 (GRCm39) nonsense probably null
R2046:Rmi1 UTSW 13 58,555,772 (GRCm39) missense probably benign
R2144:Rmi1 UTSW 13 58,555,797 (GRCm39) missense probably damaging 0.99
R4624:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R4625:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R4626:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R4627:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R4628:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R4629:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R5288:Rmi1 UTSW 13 58,557,280 (GRCm39) missense probably damaging 1.00
R6939:Rmi1 UTSW 13 58,557,169 (GRCm39) missense probably benign
R7337:Rmi1 UTSW 13 58,557,393 (GRCm39) nonsense probably null
R7741:Rmi1 UTSW 13 58,557,067 (GRCm39) missense probably benign
R8871:Rmi1 UTSW 13 58,557,156 (GRCm39) missense probably benign 0.04
R9268:Rmi1 UTSW 13 58,555,853 (GRCm39) missense probably damaging 0.99
R9269:Rmi1 UTSW 13 58,556,840 (GRCm39) missense probably benign 0.12
R9627:Rmi1 UTSW 13 58,557,366 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CTTTTGGAAGAGACTGTCCAGAAAG -3'
(R):5'- CTGGAAAGGGTGGCCATTTTC -3'

Sequencing Primer
(F):5'- CTGTCCAGAAAGAACAGATGGAAAC -3'
(R):5'- GTGAACTCTTTTCTGATAGGTCCAGC -3'
Posted On 2022-03-25