Incidental Mutation 'R9248:Jakmip2'
ID 701395
Institutional Source Beutler Lab
Gene Symbol Jakmip2
Ensembl Gene ENSMUSG00000024502
Gene Name janus kinase and microtubule interacting protein 2
Synonyms 6430702L21Rik, D930046L20Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock # R9248 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 43531408-43687773 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 43552177 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 682 (M682R)
Ref Sequence ENSEMBL: ENSMUSP00000080881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082254]
AlphaFold D3YXK0
Predicted Effect probably benign
Transcript: ENSMUST00000082254
AA Change: M682R

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000080881
Gene: ENSMUSG00000024502
AA Change: M682R

DomainStartEndE-ValueType
coiled coil region 13 102 N/A INTRINSIC
coiled coil region 206 249 N/A INTRINSIC
Pfam:JAKMIP_CC3 409 602 2.3e-86 PFAM
coiled coil region 698 808 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is reported to be a component of the Golgi matrix. It may act as a golgin protein by negatively regulating transit of secretory cargo and by acting as a structural scaffold of the Golgi. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T C 9: 119,153,934 N132S probably benign Het
Agpat2 A G 2: 26,593,589 *279Q probably null Het
Akr1c19 C A 13: 4,242,975 D243E probably benign Het
Alg2 A G 4: 47,474,001 F96L probably benign Het
Apob C T 12: 8,015,231 Q4067* probably null Het
C1ra A T 6: 124,512,621 probably benign Het
C8a T C 4: 104,846,002 Y330C probably damaging Het
Ccdc185 A G 1: 182,748,656 V156A probably benign Het
Ces1g A G 8: 93,333,691 L100P possibly damaging Het
Cnbd1 T C 4: 18,862,113 N359S possibly damaging Het
Crybb2 C T 5: 113,063,228 A65T probably benign Het
Dcaf5 T C 12: 80,339,789 D521G probably benign Het
Dnmt1 A G 9: 20,922,112 F631L possibly damaging Het
Dok1 T A 6: 83,031,912 D263V possibly damaging Het
Ecel1 A G 1: 87,153,390 F293L probably benign Het
Ehmt1 A T 2: 24,848,065 L509Q possibly damaging Het
Fbln2 T A 6: 91,254,574 V551E possibly damaging Het
Fig4 C T 10: 41,277,482 V108I probably benign Het
Gpa33 A G 1: 166,163,827 Y209C probably damaging Het
Heatr5a T C 12: 51,916,243 H52R Het
Heatr9 A T 11: 83,518,455 D157E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Layn A G 9: 51,057,460 S328P possibly damaging Het
Mblac2 A G 13: 81,711,650 D41G probably damaging Het
Mboat1 A G 13: 30,226,409 Y283C probably damaging Het
Mdga2 A G 12: 66,689,452 V334A possibly damaging Het
Mroh4 C T 15: 74,613,318 R515H possibly damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nsrp1 G A 11: 77,046,210 R387W probably benign Het
Olfr483 T C 7: 108,104,049 S247P probably damaging Het
Olfr894 T C 9: 38,219,410 Y193H probably benign Het
Ostm1 T C 10: 42,698,214 V301A probably damaging Het
Pcdhb13 A T 18: 37,444,555 D662V probably damaging Het
Pfpl T A 19: 12,429,010 S208R probably damaging Het
Plin5 A T 17: 56,112,324 V366E probably damaging Het
Rmi1 A G 13: 58,409,085 I383V probably benign Het
Rnh1 T C 7: 141,160,801 T414A probably benign Het
Sash1 C A 10: 8,741,532 G537W probably damaging Het
Slc9c1 A G 16: 45,550,188 N264S probably benign Het
Speg A C 1: 75,421,776 T1956P probably damaging Het
St14 T C 9: 31,091,609 Y666C probably damaging Het
Stab2 T A 10: 86,891,617 H1448L probably damaging Het
Syne2 C T 12: 76,107,456 probably benign Het
Taf9 T A 13: 100,654,352 probably benign Het
Thumpd2 G A 17: 81,026,611 A516V possibly damaging Het
Tmem132e A G 11: 82,444,482 K797E probably damaging Het
Tpte A G 8: 22,351,473 T494A possibly damaging Het
Ttc41 T A 10: 86,731,249 L593Q probably benign Het
Uggt1 A C 1: 36,210,022 I279S possibly damaging Het
Uxs1 A G 1: 43,764,924 F277S probably damaging Het
Vat1 A T 11: 101,460,554 N320K possibly damaging Het
Wdr81 G T 11: 75,445,430 A592E Het
Zfp780b C T 7: 27,973,718 probably null Het
Zfp944 A T 17: 22,343,638 probably null Het
Zfp956 G T 6: 47,957,503 G136W possibly damaging Het
Other mutations in Jakmip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Jakmip2 APN 18 43590679 utr 5 prime probably benign
IGL01311:Jakmip2 APN 18 43557324 splice site probably benign
IGL01467:Jakmip2 APN 18 43582287 missense probably benign 0.34
IGL01947:Jakmip2 APN 18 43547094 missense probably benign 0.00
IGL02010:Jakmip2 APN 18 43559093 critical splice donor site probably null
IGL02040:Jakmip2 APN 18 43571854 missense probably benign
IGL02143:Jakmip2 APN 18 43563285 missense probably damaging 1.00
IGL02246:Jakmip2 APN 18 43567158 missense possibly damaging 0.82
IGL02350:Jakmip2 APN 18 43547127 missense possibly damaging 0.46
IGL02357:Jakmip2 APN 18 43547127 missense possibly damaging 0.46
IGL02725:Jakmip2 APN 18 43562590 missense probably damaging 0.99
IGL02833:Jakmip2 APN 18 43575451 splice site probably benign
IGL02866:Jakmip2 APN 18 43552201 missense probably benign 0.28
IGL02981:Jakmip2 APN 18 43562530 critical splice donor site probably null
R0042:Jakmip2 UTSW 18 43552145 splice site probably benign
R0044:Jakmip2 UTSW 18 43582105 missense probably benign
R0436:Jakmip2 UTSW 18 43558169 nonsense probably null
R1453:Jakmip2 UTSW 18 43559214 splice site probably null
R1682:Jakmip2 UTSW 18 43581831 critical splice donor site probably null
R1829:Jakmip2 UTSW 18 43582080 missense possibly damaging 0.93
R1908:Jakmip2 UTSW 18 43567144 missense probably benign
R2070:Jakmip2 UTSW 18 43563330 missense probably benign 0.34
R2168:Jakmip2 UTSW 18 43565930 missense probably damaging 1.00
R2985:Jakmip2 UTSW 18 43571181 missense possibly damaging 0.79
R3896:Jakmip2 UTSW 18 43549686 missense probably benign 0.00
R4243:Jakmip2 UTSW 18 43577436 missense probably benign 0.02
R4245:Jakmip2 UTSW 18 43577436 missense probably benign 0.02
R4614:Jakmip2 UTSW 18 43562592 missense probably damaging 1.00
R4687:Jakmip2 UTSW 18 43577412 missense possibly damaging 0.52
R4830:Jakmip2 UTSW 18 43567143 missense probably benign 0.00
R4852:Jakmip2 UTSW 18 43577400 missense probably damaging 0.99
R5099:Jakmip2 UTSW 18 43568108 missense probably benign 0.20
R5381:Jakmip2 UTSW 18 43581960 missense probably damaging 1.00
R5753:Jakmip2 UTSW 18 43559116 missense probably damaging 0.99
R5883:Jakmip2 UTSW 18 43581994 missense possibly damaging 0.59
R6261:Jakmip2 UTSW 18 43575534 missense probably benign 0.01
R6382:Jakmip2 UTSW 18 43571179 missense possibly damaging 0.66
R6527:Jakmip2 UTSW 18 43556524 missense possibly damaging 0.94
R6612:Jakmip2 UTSW 18 43557367 missense probably damaging 1.00
R6679:Jakmip2 UTSW 18 43565949 missense probably damaging 0.98
R7070:Jakmip2 UTSW 18 43557328 critical splice donor site probably null
R7103:Jakmip2 UTSW 18 43540583 splice site probably null
R7434:Jakmip2 UTSW 18 43557379 missense possibly damaging 0.94
R7446:Jakmip2 UTSW 18 43577325 missense probably damaging 1.00
R7515:Jakmip2 UTSW 18 43571126 missense probably benign 0.01
R7586:Jakmip2 UTSW 18 43540611 missense probably damaging 0.98
R7720:Jakmip2 UTSW 18 43571908 missense possibly damaging 0.51
R7999:Jakmip2 UTSW 18 43563333 missense probably benign 0.21
R9002:Jakmip2 UTSW 18 43582258 missense probably benign 0.05
R9184:Jakmip2 UTSW 18 43582287 missense probably benign 0.34
R9252:Jakmip2 UTSW 18 43582129 missense possibly damaging 0.92
R9674:Jakmip2 UTSW 18 43571896 missense probably benign
R9691:Jakmip2 UTSW 18 43540620 missense probably damaging 0.99
R9788:Jakmip2 UTSW 18 43571862 missense probably damaging 1.00
X0057:Jakmip2 UTSW 18 43565970 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CTTTGGGGAAAGACTAGAGCTG -3'
(R):5'- TAACACTCCTTCAGACTCCTGG -3'

Sequencing Primer
(F):5'- AGACTAGAGCTGGAGGTTATGTTAC -3'
(R):5'- TTCAGACTCCTGGAGATAAAAGTGC -3'
Posted On 2022-03-25