Incidental Mutation 'R9249:Sgsm1'
ID 701417
Institutional Source Beutler Lab
Gene Symbol Sgsm1
Ensembl Gene ENSMUSG00000042216
Gene Name small G protein signaling modulator 1
Synonyms Rutbc2, 2410098H20Rik, D5Bwg1524e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9249 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 113243220-113310786 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 113280335 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 329 (H329L)
Ref Sequence ENSEMBL: ENSMUSP00000046544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048112] [ENSMUST00000057209] [ENSMUST00000112324] [ENSMUST00000112325] [ENSMUST00000154248]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000048112
AA Change: H329L

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046544
Gene: ENSMUSG00000042216
AA Change: H329L

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
TBC 559 1053 2.88e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000057209
AA Change: H42L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084106
Gene: ENSMUSG00000042216
AA Change: H42L

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
TBC 272 766 2.88e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112324
AA Change: H42L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107943
Gene: ENSMUSG00000042216
AA Change: H42L

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112325
AA Change: H329L

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107944
Gene: ENSMUSG00000042216
AA Change: H329L

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
SCOP:d1fkma1 539 615 1e-6 SMART
Blast:TBC 559 675 1e-71 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000154248
AA Change: H329L

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114932
Gene: ENSMUSG00000042216
AA Change: H329L

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
SCOP:d1fkma1 594 670 9e-7 SMART
Blast:TBC 614 706 3e-55 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,329,339 probably benign Het
AI314180 T C 4: 58,869,427 K280R probably damaging Het
Arfgef2 T C 2: 166,891,770 F1650S probably damaging Het
Bscl2 A T 19: 8,843,014 D133V probably damaging Het
Cacna1c T C 6: 118,613,327 Y1564C Het
Ccdc182 T C 11: 88,294,352 V86A probably benign Het
Cd44 T G 2: 102,831,402 T616P possibly damaging Het
Cep152 C T 2: 125,563,984 E1543K probably benign Het
Chpf2 C A 5: 24,589,237 T135K probably damaging Het
Cntn4 C T 6: 106,489,761 P208L possibly damaging Het
Col6a3 T A 1: 90,779,298 Y2638F unknown Het
Csmd2 C A 4: 128,419,530 Y1333* probably null Het
Cyp3a25 T C 5: 145,991,546 T230A possibly damaging Het
Dbndd2 T C 2: 164,486,157 probably benign Het
Egfl8 C A 17: 34,614,517 A133S probably benign Het
Fasn T C 11: 120,813,089 H1475R probably benign Het
Gdpd5 T C 7: 99,458,782 L522P probably damaging Het
Gzmd T G 14: 56,131,333 M35L probably damaging Het
Herc2 T A 7: 56,113,142 L873Q probably damaging Het
Hsd3b6 T C 3: 98,806,363 K207E probably benign Het
Ikbkb T A 8: 22,681,719 K171* probably null Het
Il21 T A 3: 37,225,528 probably null Het
Itga1 T C 13: 115,049,298 N56S probably damaging Het
Map1lc3b T C 8: 121,596,094 probably null Het
Mapk13 A G 17: 28,769,516 Y36C probably damaging Het
Myh3 C T 11: 67,085,029 P296S probably benign Het
Myo5a A G 9: 75,189,997 N1319S possibly damaging Het
Myot T C 18: 44,346,198 V334A probably benign Het
Ncor2 T C 5: 125,109,924 E12G unknown Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nphs2 G A 1: 156,316,846 R140Q probably damaging Het
Nup98 C A 7: 102,138,830 R1011L probably benign Het
Nvl A G 1: 181,135,028 Y126H probably damaging Het
Olfr1134 A T 2: 87,656,316 F202I probably benign Het
Olfr342 T C 2: 36,527,547 I45T probably damaging Het
Olfr947-ps1 T A 9: 39,289,306 N195Y unknown Het
Olfr957 A T 9: 39,510,853 I289N probably damaging Het
Osbpl8 T A 10: 111,286,151 D651E probably benign Het
Papola T A 12: 105,833,144 H677Q probably benign Het
Pcbp3 T C 10: 76,799,543 S59G probably benign Het
Pkd1l2 T A 8: 117,019,420 I1944F probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Polb A T 8: 22,653,068 N37K probably benign Het
Ppfia2 T C 10: 106,913,568 V1105A probably damaging Het
Ric3 C T 7: 109,048,005 D204N probably damaging Het
Scn8a A G 15: 101,016,575 D1154G probably benign Het
Sdk1 C A 5: 142,143,795 N1590K probably damaging Het
Sec31a C A 5: 100,385,224 R163L probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Serpina3i C T 12: 104,265,469 Q122* probably null Het
Sgo2b A C 8: 63,938,373 Y153* probably null Het
Sh3tc2 A C 18: 61,974,527 N203T possibly damaging Het
Skint8 C A 4: 111,936,962 T183K probably damaging Het
Slc6a20a T C 9: 123,678,876 probably benign Het
Slc8a2 T C 7: 16,157,231 F732S probably damaging Het
Spata16 T C 3: 26,732,881 V236A possibly damaging Het
Stard5 A G 7: 83,632,045 D2G probably damaging Het
Stk25 T C 1: 93,625,084 S328G probably benign Het
Tmem39b A T 4: 129,678,675 M378K probably damaging Het
Tspan10 T C 11: 120,446,225 F274L probably benign Het
Tssk1 A T 16: 17,894,860 I170L probably benign Het
Vmn1r6 A G 6: 57,002,775 R141G probably benign Het
Wdfy3 A G 5: 101,848,493 S3168P possibly damaging Het
Zfp458 T A 13: 67,257,154 H407L probably damaging Het
Other mutations in Sgsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Sgsm1 APN 5 113245064 missense probably benign 0.00
IGL00503:Sgsm1 APN 5 113276142 missense probably benign 0.00
IGL01377:Sgsm1 APN 5 113276182 splice site probably benign
IGL01602:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01605:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01669:Sgsm1 APN 5 113263490 missense probably benign
IGL01920:Sgsm1 APN 5 113273605 missense probably damaging 1.00
IGL01951:Sgsm1 APN 5 113286767 splice site probably benign
IGL02387:Sgsm1 APN 5 113253063 missense possibly damaging 0.93
IGL02690:Sgsm1 APN 5 113286767 splice site probably benign
IGL03177:Sgsm1 APN 5 113250993 missense probably damaging 1.00
IGL03186:Sgsm1 APN 5 113285021 missense probably benign 0.00
IGL03398:Sgsm1 APN 5 113255316 missense possibly damaging 0.67
caliente UTSW 5 113280462 intron probably benign
Chili UTSW 5 113258123 intron probably benign
pimiento UTSW 5 113263257 missense probably benign 0.15
R0048:Sgsm1 UTSW 5 113268750 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0082:Sgsm1 UTSW 5 113288836 missense probably benign 0.01
R0085:Sgsm1 UTSW 5 113279270 splice site probably benign
R0099:Sgsm1 UTSW 5 113274360 splice site probably benign
R0269:Sgsm1 UTSW 5 113286929 critical splice acceptor site probably null
R0310:Sgsm1 UTSW 5 113263705 missense probably benign 0.00
R0325:Sgsm1 UTSW 5 113288835 missense probably damaging 0.99
R0420:Sgsm1 UTSW 5 113263759 missense probably benign 0.16
R0594:Sgsm1 UTSW 5 113310562 missense probably benign 0.00
R0599:Sgsm1 UTSW 5 113245028 missense probably damaging 1.00
R0631:Sgsm1 UTSW 5 113285123 splice site probably benign
R0744:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0833:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0919:Sgsm1 UTSW 5 113258842 missense probably damaging 1.00
R0944:Sgsm1 UTSW 5 113265874 missense probably benign 0.40
R1169:Sgsm1 UTSW 5 113279485 missense probably damaging 1.00
R1232:Sgsm1 UTSW 5 113273711 nonsense probably null
R1473:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R1535:Sgsm1 UTSW 5 113263269 missense possibly damaging 0.93
R1796:Sgsm1 UTSW 5 113273617 missense possibly damaging 0.58
R1878:Sgsm1 UTSW 5 113263515 missense probably damaging 0.97
R2084:Sgsm1 UTSW 5 113285400 missense probably damaging 1.00
R3855:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R3856:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R4294:Sgsm1 UTSW 5 113285404 missense probably damaging 1.00
R4373:Sgsm1 UTSW 5 113258123 intron probably benign
R4558:Sgsm1 UTSW 5 113258111 intron probably benign
R4610:Sgsm1 UTSW 5 113255307 missense probably damaging 1.00
R4667:Sgsm1 UTSW 5 113260047 critical splice donor site probably null
R4838:Sgsm1 UTSW 5 113282626 missense probably damaging 1.00
R4890:Sgsm1 UTSW 5 113280462 intron probably benign
R4992:Sgsm1 UTSW 5 113282620 missense possibly damaging 0.89
R5366:Sgsm1 UTSW 5 113251039 missense possibly damaging 0.91
R5776:Sgsm1 UTSW 5 113250957 missense probably damaging 1.00
R5813:Sgsm1 UTSW 5 113250956 missense probably damaging 1.00
R6000:Sgsm1 UTSW 5 113286838 missense probably damaging 1.00
R6354:Sgsm1 UTSW 5 113282656 missense probably damaging 0.99
R6440:Sgsm1 UTSW 5 113279131 critical splice donor site probably null
R6831:Sgsm1 UTSW 5 113280380 missense probably damaging 0.97
R7307:Sgsm1 UTSW 5 113273646 missense probably benign 0.00
R7309:Sgsm1 UTSW 5 113268846 splice site probably null
R7387:Sgsm1 UTSW 5 113263700 missense probably damaging 1.00
R7439:Sgsm1 UTSW 5 113274321 missense probably damaging 0.99
R7485:Sgsm1 UTSW 5 113279635 splice site probably null
R7624:Sgsm1 UTSW 5 113274335 nonsense probably null
R7632:Sgsm1 UTSW 5 113276082 missense possibly damaging 0.54
R7669:Sgsm1 UTSW 5 113253024 missense probably damaging 1.00
R7727:Sgsm1 UTSW 5 113274327 missense possibly damaging 0.95
R7732:Sgsm1 UTSW 5 113266330 missense probably benign 0.26
R7961:Sgsm1 UTSW 5 113282644 missense probably damaging 1.00
R8088:Sgsm1 UTSW 5 113255268 missense probably damaging 1.00
R8213:Sgsm1 UTSW 5 113251011 missense probably damaging 1.00
R8278:Sgsm1 UTSW 5 113260092 missense probably damaging 0.98
R8480:Sgsm1 UTSW 5 113263418 missense probably benign 0.01
R8796:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R8816:Sgsm1 UTSW 5 113287231 missense probably damaging 1.00
R8904:Sgsm1 UTSW 5 113273629 missense probably benign 0.00
R8905:Sgsm1 UTSW 5 113273629 missense probably benign 0.00
R8952:Sgsm1 UTSW 5 113284995 missense probably damaging 1.00
R9046:Sgsm1 UTSW 5 113288859 missense probably damaging 1.00
R9162:Sgsm1 UTSW 5 113282711 missense probably damaging 1.00
R9375:Sgsm1 UTSW 5 113274273 missense unknown
R9377:Sgsm1 UTSW 5 113288875 missense probably damaging 1.00
R9461:Sgsm1 UTSW 5 113276032 critical splice donor site probably null
R9662:Sgsm1 UTSW 5 113279231 missense probably benign 0.03
R9722:Sgsm1 UTSW 5 113280341 missense possibly damaging 0.75
R9726:Sgsm1 UTSW 5 113310552 missense probably benign
Z1177:Sgsm1 UTSW 5 113282710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGGTTGCAGTGATTCAGAGC -3'
(R):5'- AGCTCCGGTAACTTCATAGACAG -3'

Sequencing Primer
(F):5'- TGATTCAGAGCTGGCACACTCAG -3'
(R):5'- CAGGGAGAAGGGGTTTTACTC -3'
Posted On 2022-03-25