Incidental Mutation 'R9250:Slc9a2'
ID 701463
Institutional Source Beutler Lab
Gene Symbol Slc9a2
Ensembl Gene ENSMUSG00000026062
Gene Name solute carrier family 9 (sodium/hydrogen exchanger), member 2
Synonyms 2210416H12Rik, NHE2, 4932415O19Rik
MMRRC Submission 068989-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R9250 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 40720872-40808045 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 40806987 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 758 (T758I)
Ref Sequence ENSEMBL: ENSMUSP00000027231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027231] [ENSMUST00000039672] [ENSMUST00000131390]
AlphaFold Q3ZAS0
Predicted Effect probably benign
Transcript: ENSMUST00000027231
AA Change: T758I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: T758I

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 486 1.4e-95 PFAM
low complexity region 528 543 N/A INTRINSIC
Pfam:NEXCaM_BD 576 685 3e-44 PFAM
low complexity region 738 753 N/A INTRINSIC
low complexity region 788 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039672
SMART Domains Protein: ENSMUSP00000035727
Gene: ENSMUSG00000041945

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
Pfam:Sugar_tr 39 301 4.7e-8 PFAM
Pfam:MFS_1 39 419 1.8e-42 PFAM
low complexity region 436 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131390
SMART Domains Protein: ENSMUSP00000137884
Gene: ENSMUSG00000041945

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
low complexity region 36 46 N/A INTRINSIC
Meta Mutation Damage Score 0.1233 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C G 3: 137,772,389 (GRCm39) A526G probably damaging Het
AAdacl4fm3 A T 4: 144,442,011 (GRCm39) I80K probably benign Het
Ablim3 A G 18: 61,944,501 (GRCm39) L526P probably damaging Het
Aknad1 T C 3: 108,664,143 (GRCm39) S369P probably damaging Het
Aldh8a1 T C 10: 21,258,259 (GRCm39) S119P probably damaging Het
Brpf3 T C 17: 29,054,788 (GRCm39) I1110T probably damaging Het
Cdk12 T C 11: 98,101,398 (GRCm39) S419P probably benign Het
Cmklr1 G C 5: 113,752,043 (GRCm39) H319Q probably benign Het
Crim1 C T 17: 78,677,471 (GRCm39) H891Y probably benign Het
Dapp1 T C 3: 137,638,919 (GRCm39) E269G probably benign Het
Ddt T C 10: 75,609,063 (GRCm39) D32G probably benign Het
Dlg5 T C 14: 24,240,543 (GRCm39) D236G probably benign Het
Edem1 C A 6: 108,805,850 (GRCm39) D50E probably benign Het
Exoc5 A T 14: 49,256,915 (GRCm39) N490K probably damaging Het
Fam117a C A 11: 95,228,071 (GRCm39) D60E possibly damaging Het
Fam186a A G 15: 99,845,330 (GRCm39) S305P unknown Het
Fbxw21 A G 9: 108,972,846 (GRCm39) F363L probably benign Het
Fhl2 A G 1: 43,167,422 (GRCm39) C224R probably damaging Het
Gad1 T A 2: 70,409,543 (GRCm39) N211K probably damaging Het
Igdcc4 A G 9: 65,038,932 (GRCm39) T906A possibly damaging Het
Igkv3-5 T C 6: 70,640,758 (GRCm39) S80P probably benign Het
Igkv4-90 C A 6: 68,784,331 (GRCm39) G62* probably null Het
Il31ra A T 13: 112,669,508 (GRCm39) Y386N probably damaging Het
Kif13a G T 13: 46,928,909 (GRCm39) H1159N probably damaging Het
Kmt2a G A 9: 44,759,683 (GRCm39) S722F possibly damaging Het
Mipep T C 14: 61,028,358 (GRCm39) Y157H probably damaging Het
Mipol1 A G 12: 57,461,169 (GRCm39) E293G probably damaging Het
Mmp7 A T 9: 7,697,885 (GRCm39) probably benign Het
Mr1 A G 1: 155,013,325 (GRCm39) L84P probably damaging Het
Neb A G 2: 52,168,913 (GRCm39) V1874A possibly damaging Het
Nefm T C 14: 68,358,570 (GRCm39) probably benign Het
Nek1 T C 8: 61,465,151 (GRCm39) M80T probably damaging Het
Nubp2 A G 17: 25,103,373 (GRCm39) probably null Het
Or10ab4 C T 7: 107,655,014 (GRCm39) T275M probably damaging Het
Or5w11 T C 2: 87,459,278 (GRCm39) I41T probably benign Het
Or8b101 T A 9: 38,020,718 (GRCm39) C240* probably null Het
Ovch2 C A 7: 107,392,542 (GRCm39) R267L probably damaging Het
Pole A G 5: 110,447,687 (GRCm39) E741G possibly damaging Het
Ptprh T A 7: 4,576,289 (GRCm39) T324S probably benign Het
Pxk T A 14: 8,144,123 (GRCm38) H290Q probably damaging Het
Rab11fip3 G T 17: 26,237,219 (GRCm39) T5N unknown Het
Rp9 G A 9: 22,365,086 (GRCm39) Q124* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,121 (GRCm39) probably benign Het
Runx2 A G 17: 45,125,459 (GRCm39) L19P probably benign Het
Sf1 C T 19: 6,424,764 (GRCm39) P473L unknown Het
Spef1l C A 7: 139,556,395 (GRCm39) K197N probably benign Het
Tas2r105 T G 6: 131,663,951 (GRCm39) H159P probably benign Het
Tas2r120 T A 6: 132,633,954 (GRCm39) M12K probably benign Het
Thoc2l A G 5: 104,667,320 (GRCm39) Y614C probably benign Het
Trpv4 T C 5: 114,764,941 (GRCm39) Y691C probably damaging Het
Unc93a A G 17: 13,334,488 (GRCm39) V337A probably benign Het
Usp17le T G 7: 104,418,839 (GRCm39) Q101P probably damaging Het
Usp3 A T 9: 66,449,793 (GRCm39) probably null Het
Zfp445 T C 9: 122,681,092 (GRCm39) S950G possibly damaging Het
Zfp644 T G 5: 106,784,699 (GRCm39) D616A probably damaging Het
Zfp759 T G 13: 67,288,461 (GRCm39) C671G probably damaging Het
Zgrf1 G T 3: 127,379,797 (GRCm39) C1111F probably damaging Het
Zmym2 T A 14: 57,148,732 (GRCm39) S349T probably damaging Het
Other mutations in Slc9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Slc9a2 APN 1 40,806,897 (GRCm39) missense probably benign
IGL00487:Slc9a2 APN 1 40,781,818 (GRCm39) missense probably damaging 0.99
IGL00500:Slc9a2 APN 1 40,802,743 (GRCm39) missense possibly damaging 0.95
IGL01445:Slc9a2 APN 1 40,757,970 (GRCm39) missense possibly damaging 0.51
IGL02060:Slc9a2 APN 1 40,795,453 (GRCm39) missense probably damaging 0.99
IGL02813:Slc9a2 APN 1 40,781,829 (GRCm39) missense probably damaging 1.00
IGL02894:Slc9a2 APN 1 40,802,762 (GRCm39) missense probably benign 0.20
IGL02939:Slc9a2 APN 1 40,781,863 (GRCm39) missense probably damaging 1.00
IGL03193:Slc9a2 APN 1 40,795,431 (GRCm39) missense probably benign 0.00
putty UTSW 1 40,781,813 (GRCm39) nonsense probably null
E0370:Slc9a2 UTSW 1 40,802,701 (GRCm39) critical splice acceptor site probably null
PIT4377001:Slc9a2 UTSW 1 40,783,001 (GRCm39) missense probably damaging 1.00
R0009:Slc9a2 UTSW 1 40,802,762 (GRCm39) missense probably benign 0.38
R0009:Slc9a2 UTSW 1 40,802,762 (GRCm39) missense probably benign 0.38
R0152:Slc9a2 UTSW 1 40,781,964 (GRCm39) missense probably damaging 1.00
R0374:Slc9a2 UTSW 1 40,783,017 (GRCm39) missense possibly damaging 0.93
R1386:Slc9a2 UTSW 1 40,758,178 (GRCm39) missense probably damaging 1.00
R1485:Slc9a2 UTSW 1 40,765,548 (GRCm39) missense probably damaging 1.00
R1712:Slc9a2 UTSW 1 40,802,770 (GRCm39) missense possibly damaging 0.90
R1779:Slc9a2 UTSW 1 40,781,803 (GRCm39) missense probably damaging 0.99
R2051:Slc9a2 UTSW 1 40,765,597 (GRCm39) missense probably damaging 1.00
R2166:Slc9a2 UTSW 1 40,781,928 (GRCm39) missense probably damaging 1.00
R2513:Slc9a2 UTSW 1 40,781,768 (GRCm39) splice site probably null
R3612:Slc9a2 UTSW 1 40,758,218 (GRCm39) splice site probably null
R4631:Slc9a2 UTSW 1 40,801,078 (GRCm39) missense possibly damaging 0.66
R4760:Slc9a2 UTSW 1 40,801,076 (GRCm39) missense probably damaging 1.00
R4768:Slc9a2 UTSW 1 40,765,534 (GRCm39) missense probably damaging 1.00
R4769:Slc9a2 UTSW 1 40,765,534 (GRCm39) missense probably damaging 1.00
R4815:Slc9a2 UTSW 1 40,758,009 (GRCm39) missense probably benign 0.00
R4920:Slc9a2 UTSW 1 40,794,878 (GRCm39) missense probably benign 0.05
R5191:Slc9a2 UTSW 1 40,783,053 (GRCm39) missense probably damaging 1.00
R5963:Slc9a2 UTSW 1 40,721,196 (GRCm39) missense possibly damaging 0.94
R6322:Slc9a2 UTSW 1 40,781,813 (GRCm39) nonsense probably null
R6453:Slc9a2 UTSW 1 40,781,781 (GRCm39) missense possibly damaging 0.64
R6685:Slc9a2 UTSW 1 40,758,069 (GRCm39) missense probably damaging 0.99
R7088:Slc9a2 UTSW 1 40,765,539 (GRCm39) missense probably damaging 1.00
R7302:Slc9a2 UTSW 1 40,806,828 (GRCm39) missense possibly damaging 0.58
R7450:Slc9a2 UTSW 1 40,720,995 (GRCm39) start gained probably benign
R7670:Slc9a2 UTSW 1 40,758,157 (GRCm39) missense probably damaging 1.00
R7970:Slc9a2 UTSW 1 40,765,374 (GRCm39) missense probably damaging 0.98
R8104:Slc9a2 UTSW 1 40,757,809 (GRCm39) missense probably damaging 1.00
R8776:Slc9a2 UTSW 1 40,781,889 (GRCm39) missense probably damaging 1.00
R8776-TAIL:Slc9a2 UTSW 1 40,781,889 (GRCm39) missense probably damaging 1.00
R8887:Slc9a2 UTSW 1 40,758,009 (GRCm39) missense probably benign 0.01
R9028:Slc9a2 UTSW 1 40,765,612 (GRCm39) missense probably damaging 1.00
R9189:Slc9a2 UTSW 1 40,794,944 (GRCm39) missense probably benign 0.21
R9245:Slc9a2 UTSW 1 40,805,460 (GRCm39) missense probably benign 0.27
R9400:Slc9a2 UTSW 1 40,758,211 (GRCm39) missense possibly damaging 0.65
R9512:Slc9a2 UTSW 1 40,721,258 (GRCm39) missense probably damaging 0.98
R9583:Slc9a2 UTSW 1 40,721,061 (GRCm39) missense probably benign
X0054:Slc9a2 UTSW 1 40,781,847 (GRCm39) missense probably damaging 0.99
Z1176:Slc9a2 UTSW 1 40,806,871 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAAATAGCAGCGACTCGG -3'
(R):5'- TTCACCCCAAGTCGGCTTTG -3'

Sequencing Primer
(F):5'- GACTCGGACCCAGATGTTG -3'
(R):5'- CAAGTCGGCTTTGGCTTCTTATCATG -3'
Posted On 2022-03-25