Incidental Mutation 'R9250:1110002E22Rik'
ID 701472
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene Name RIKEN cDNA 1110002E22 gene
Synonyms
MMRRC Submission 068989-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.545) question?
Stock # R9250 (G1)
Quality Score 152.008
Status Validated
Chromosome 3
Chromosomal Location 137770813-137787267 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 137772389 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glycine at position 526 (A526G)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect probably damaging
Transcript: ENSMUST00000163080
AA Change: A526G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: A526G

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AAdacl4fm3 A T 4: 144,442,011 (GRCm39) I80K probably benign Het
Ablim3 A G 18: 61,944,501 (GRCm39) L526P probably damaging Het
Aknad1 T C 3: 108,664,143 (GRCm39) S369P probably damaging Het
Aldh8a1 T C 10: 21,258,259 (GRCm39) S119P probably damaging Het
Brpf3 T C 17: 29,054,788 (GRCm39) I1110T probably damaging Het
Cdk12 T C 11: 98,101,398 (GRCm39) S419P probably benign Het
Cmklr1 G C 5: 113,752,043 (GRCm39) H319Q probably benign Het
Crim1 C T 17: 78,677,471 (GRCm39) H891Y probably benign Het
Dapp1 T C 3: 137,638,919 (GRCm39) E269G probably benign Het
Ddt T C 10: 75,609,063 (GRCm39) D32G probably benign Het
Dlg5 T C 14: 24,240,543 (GRCm39) D236G probably benign Het
Edem1 C A 6: 108,805,850 (GRCm39) D50E probably benign Het
Exoc5 A T 14: 49,256,915 (GRCm39) N490K probably damaging Het
Fam117a C A 11: 95,228,071 (GRCm39) D60E possibly damaging Het
Fam186a A G 15: 99,845,330 (GRCm39) S305P unknown Het
Fbxw21 A G 9: 108,972,846 (GRCm39) F363L probably benign Het
Fhl2 A G 1: 43,167,422 (GRCm39) C224R probably damaging Het
Gad1 T A 2: 70,409,543 (GRCm39) N211K probably damaging Het
Igdcc4 A G 9: 65,038,932 (GRCm39) T906A possibly damaging Het
Igkv3-5 T C 6: 70,640,758 (GRCm39) S80P probably benign Het
Igkv4-90 C A 6: 68,784,331 (GRCm39) G62* probably null Het
Il31ra A T 13: 112,669,508 (GRCm39) Y386N probably damaging Het
Kif13a G T 13: 46,928,909 (GRCm39) H1159N probably damaging Het
Kmt2a G A 9: 44,759,683 (GRCm39) S722F possibly damaging Het
Mipep T C 14: 61,028,358 (GRCm39) Y157H probably damaging Het
Mipol1 A G 12: 57,461,169 (GRCm39) E293G probably damaging Het
Mmp7 A T 9: 7,697,885 (GRCm39) probably benign Het
Mr1 A G 1: 155,013,325 (GRCm39) L84P probably damaging Het
Neb A G 2: 52,168,913 (GRCm39) V1874A possibly damaging Het
Nefm T C 14: 68,358,570 (GRCm39) probably benign Het
Nek1 T C 8: 61,465,151 (GRCm39) M80T probably damaging Het
Nubp2 A G 17: 25,103,373 (GRCm39) probably null Het
Or10ab4 C T 7: 107,655,014 (GRCm39) T275M probably damaging Het
Or5w11 T C 2: 87,459,278 (GRCm39) I41T probably benign Het
Or8b101 T A 9: 38,020,718 (GRCm39) C240* probably null Het
Ovch2 C A 7: 107,392,542 (GRCm39) R267L probably damaging Het
Pole A G 5: 110,447,687 (GRCm39) E741G possibly damaging Het
Ptprh T A 7: 4,576,289 (GRCm39) T324S probably benign Het
Pxk T A 14: 8,144,123 (GRCm38) H290Q probably damaging Het
Rab11fip3 G T 17: 26,237,219 (GRCm39) T5N unknown Het
Rp9 G A 9: 22,365,086 (GRCm39) Q124* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,121 (GRCm39) probably benign Het
Runx2 A G 17: 45,125,459 (GRCm39) L19P probably benign Het
Sf1 C T 19: 6,424,764 (GRCm39) P473L unknown Het
Slc9a2 C T 1: 40,806,987 (GRCm39) T758I probably benign Het
Spef1l C A 7: 139,556,395 (GRCm39) K197N probably benign Het
Tas2r105 T G 6: 131,663,951 (GRCm39) H159P probably benign Het
Tas2r120 T A 6: 132,633,954 (GRCm39) M12K probably benign Het
Thoc2l A G 5: 104,667,320 (GRCm39) Y614C probably benign Het
Trpv4 T C 5: 114,764,941 (GRCm39) Y691C probably damaging Het
Unc93a A G 17: 13,334,488 (GRCm39) V337A probably benign Het
Usp17le T G 7: 104,418,839 (GRCm39) Q101P probably damaging Het
Usp3 A T 9: 66,449,793 (GRCm39) probably null Het
Zfp445 T C 9: 122,681,092 (GRCm39) S950G possibly damaging Het
Zfp644 T G 5: 106,784,699 (GRCm39) D616A probably damaging Het
Zfp759 T G 13: 67,288,461 (GRCm39) C671G probably damaging Het
Zgrf1 G T 3: 127,379,797 (GRCm39) C1111F probably damaging Het
Zmym2 T A 14: 57,148,732 (GRCm39) S349T probably damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 137,772,566 (GRCm39) missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 137,772,025 (GRCm39) missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 137,772,025 (GRCm39) missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 137,773,874 (GRCm39) missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 137,773,874 (GRCm39) missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 137,775,632 (GRCm39) missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 137,771,595 (GRCm39) small deletion probably benign
R0394:1110002E22Rik UTSW 3 137,773,065 (GRCm39) missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 137,776,067 (GRCm39) missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 137,774,005 (GRCm39) missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 137,774,704 (GRCm39) nonsense probably null
R0711:1110002E22Rik UTSW 3 137,773,986 (GRCm39) missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 137,775,632 (GRCm39) missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 137,775,838 (GRCm39) missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 137,772,967 (GRCm39) missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 137,772,632 (GRCm39) missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 137,773,661 (GRCm39) missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 137,773,313 (GRCm39) missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 137,771,162 (GRCm39) missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 137,775,181 (GRCm39) missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 137,772,479 (GRCm39) missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 137,773,031 (GRCm39) missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 137,773,028 (GRCm39) missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 137,771,419 (GRCm39) nonsense probably null
R1991:1110002E22Rik UTSW 3 137,771,419 (GRCm39) nonsense probably null
R2102:1110002E22Rik UTSW 3 137,770,934 (GRCm39) missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 137,773,541 (GRCm39) missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 137,771,443 (GRCm39) missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 137,774,168 (GRCm39) missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 137,772,400 (GRCm39) missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 137,773,834 (GRCm39) missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 137,776,027 (GRCm39) missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 137,775,520 (GRCm39) missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 137,774,246 (GRCm39) missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 137,775,751 (GRCm39) missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 137,771,503 (GRCm39) missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 137,771,131 (GRCm39) missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 137,771,437 (GRCm39) missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 137,774,780 (GRCm39) missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 137,775,433 (GRCm39) missense probably benign
R5206:1110002E22Rik UTSW 3 137,772,272 (GRCm39) missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 137,771,611 (GRCm39) missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 137,773,396 (GRCm39) missense probably benign
R5374:1110002E22Rik UTSW 3 137,773,396 (GRCm39) missense probably benign
R5506:1110002E22Rik UTSW 3 137,773,708 (GRCm39) missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 137,772,260 (GRCm39) missense probably benign
R5536:1110002E22Rik UTSW 3 137,772,149 (GRCm39) missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 137,771,170 (GRCm39) missense probably benign
R5759:1110002E22Rik UTSW 3 137,774,419 (GRCm39) missense probably benign
R5933:1110002E22Rik UTSW 3 137,776,109 (GRCm39) missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 137,775,922 (GRCm39) missense probably benign
R6092:1110002E22Rik UTSW 3 137,774,701 (GRCm39) missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 137,773,741 (GRCm39) missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 137,772,383 (GRCm39) missense probably damaging 1.00
R6469:1110002E22Rik UTSW 3 137,772,736 (GRCm39) missense probably damaging 0.97
R6499:1110002E22Rik UTSW 3 137,774,561 (GRCm39) missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 137,773,288 (GRCm39) missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 137,772,386 (GRCm39) missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 137,774,915 (GRCm39) missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 137,771,971 (GRCm39) missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 137,770,930 (GRCm39) nonsense probably null
R6920:1110002E22Rik UTSW 3 137,773,811 (GRCm39) missense probably damaging 1.00
R7001:1110002E22Rik UTSW 3 137,771,272 (GRCm39) missense probably benign
R7145:1110002E22Rik UTSW 3 137,775,820 (GRCm39) missense probably damaging 1.00
R7238:1110002E22Rik UTSW 3 137,775,712 (GRCm39) missense probably damaging 1.00
R7278:1110002E22Rik UTSW 3 137,771,237 (GRCm39) missense probably benign
R7425:1110002E22Rik UTSW 3 137,771,456 (GRCm39) missense probably benign 0.00
R7487:1110002E22Rik UTSW 3 137,772,629 (GRCm39) missense probably damaging 1.00
R7557:1110002E22Rik UTSW 3 137,774,044 (GRCm39) nonsense probably null
R7663:1110002E22Rik UTSW 3 137,771,887 (GRCm39) missense probably damaging 0.98
R7743:1110002E22Rik UTSW 3 137,774,516 (GRCm39) missense probably damaging 1.00
R7799:1110002E22Rik UTSW 3 137,775,362 (GRCm39) missense probably benign 0.33
R8181:1110002E22Rik UTSW 3 137,774,156 (GRCm39) missense probably damaging 0.99
R8264:1110002E22Rik UTSW 3 137,773,543 (GRCm39) missense probably damaging 0.99
R8273:1110002E22Rik UTSW 3 137,772,211 (GRCm39) missense probably benign
R8434:1110002E22Rik UTSW 3 137,773,021 (GRCm39) missense probably damaging 0.97
R8530:1110002E22Rik UTSW 3 137,774,586 (GRCm39) missense probably damaging 0.99
R8754:1110002E22Rik UTSW 3 137,771,798 (GRCm39) missense probably benign
R8808:1110002E22Rik UTSW 3 137,775,874 (GRCm39) missense probably benign 0.01
R8891:1110002E22Rik UTSW 3 137,772,520 (GRCm39) nonsense probably null
R9026:1110002E22Rik UTSW 3 137,770,909 (GRCm39) missense possibly damaging 0.53
R9177:1110002E22Rik UTSW 3 137,775,677 (GRCm39) missense probably damaging 1.00
R9291:1110002E22Rik UTSW 3 137,772,464 (GRCm39) missense probably benign 0.02
R9293:1110002E22Rik UTSW 3 137,771,839 (GRCm39) missense possibly damaging 0.93
R9307:1110002E22Rik UTSW 3 137,771,183 (GRCm39) missense probably benign 0.04
R9439:1110002E22Rik UTSW 3 137,772,048 (GRCm39) missense probably benign 0.00
R9509:1110002E22Rik UTSW 3 137,771,595 (GRCm39) small deletion probably benign
R9582:1110002E22Rik UTSW 3 137,772,766 (GRCm39) missense probably damaging 0.99
R9599:1110002E22Rik UTSW 3 137,774,267 (GRCm39) missense probably benign 0.16
R9613:1110002E22Rik UTSW 3 137,771,126 (GRCm39) missense probably damaging 0.98
R9670:1110002E22Rik UTSW 3 137,770,894 (GRCm39) missense probably benign
X0003:1110002E22Rik UTSW 3 137,774,857 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGACCCCAGGAGACATC -3'
(R):5'- GTAGTCCACCAGCTCCTTTG -3'

Sequencing Primer
(F):5'- GATGACAATAGCTGTTACGTCAG -3'
(R):5'- AGCTCCTTTGCCCGGATG -3'
Posted On 2022-03-25