Incidental Mutation 'R9250:1110002E22Rik'
ID 701472
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene Name RIKEN cDNA 1110002E22 gene
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.680) question?
Stock # R9250 (G1)
Quality Score 152.008
Status Not validated
Chromosome 3
Chromosomal Location 138065052-138081506 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 138066628 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glycine at position 526 (A526G)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect probably damaging
Transcript: ENSMUST00000163080
AA Change: A526G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: A526G

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik C A 7: 139,976,482 K197N probably benign Het
Ablim3 A G 18: 61,811,430 L526P probably damaging Het
Aknad1 T C 3: 108,756,827 S369P probably damaging Het
Aldh8a1 T C 10: 21,382,360 S119P probably damaging Het
BC005561 A G 5: 104,519,454 Y614C probably benign Het
Brpf3 T C 17: 28,835,814 I1110T probably damaging Het
Cdk12 T C 11: 98,210,572 S419P probably benign Het
Cmklr1 G C 5: 113,613,982 H319Q probably benign Het
Crim1 C T 17: 78,370,042 H891Y probably benign Het
Dapp1 T C 3: 137,933,158 E269G probably benign Het
Ddt T C 10: 75,773,229 D32G probably benign Het
Dlg5 T C 14: 24,190,475 D236G probably benign Het
Edem1 C A 6: 108,828,889 D50E probably benign Het
Exoc5 A T 14: 49,019,458 N490K probably damaging Het
Fam117a C A 11: 95,337,245 D60E possibly damaging Het
Fam186a A G 15: 99,947,449 S305P unknown Het
Fbxw21 A G 9: 109,143,778 F363L probably benign Het
Fhl2 A G 1: 43,128,262 C224R probably damaging Het
Gad1 T A 2: 70,579,199 N211K probably damaging Het
Gm13178 A T 4: 144,715,441 I80K probably benign Het
Igdcc4 A G 9: 65,131,650 T906A possibly damaging Het
Igkv3-5 T C 6: 70,663,774 S80P probably benign Het
Igkv4-90 C A 6: 68,807,347 G62* probably null Het
Il31ra A T 13: 112,532,974 Y386N probably damaging Het
Kif13a G T 13: 46,775,433 H1159N probably damaging Het
Kmt2a G A 9: 44,848,386 S722F possibly damaging Het
Mipep T C 14: 60,790,909 Y157H probably damaging Het
Mipol1 A G 12: 57,414,383 E293G probably damaging Het
Mr1 A G 1: 155,137,579 L84P probably damaging Het
Neb A G 2: 52,278,901 V1874A possibly damaging Het
Nefm T C 14: 68,121,121 probably benign Het
Nek1 T C 8: 61,012,117 M80T probably damaging Het
Nubp2 A G 17: 24,884,399 probably null Het
Olfr1131 T C 2: 87,628,934 I41T probably benign Het
Olfr479 C T 7: 108,055,807 T275M probably damaging Het
Olfr888 T A 9: 38,109,422 C240* probably null Het
Ovch2 C A 7: 107,793,335 R267L probably damaging Het
Pole A G 5: 110,299,821 E741G possibly damaging Het
Ptprh T A 7: 4,573,290 T324S probably benign Het
Pxk T A 14: 8,144,123 H290Q probably damaging Het
Rab11fip3 G T 17: 26,018,245 T5N unknown Het
Rp9 G A 9: 22,453,790 Q124* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Runx2 A G 17: 44,814,572 L19P probably benign Het
Sf1 C T 19: 6,374,734 P473L unknown Het
Slc9a2 C T 1: 40,767,827 T758I probably benign Het
Tas2r105 T G 6: 131,686,988 H159P probably benign Het
Tas2r120 T A 6: 132,656,991 M12K probably benign Het
Trpv4 T C 5: 114,626,880 Y691C probably damaging Het
Unc93a A G 17: 13,115,601 V337A probably benign Het
Usp17le T G 7: 104,769,632 Q101P probably damaging Het
Usp3 A T 9: 66,542,511 probably null Het
Zfp445 T C 9: 122,852,027 S950G possibly damaging Het
Zfp644 T G 5: 106,636,833 D616A probably damaging Het
Zfp759 T G 13: 67,140,397 C671G probably damaging Het
Zgrf1 G T 3: 127,586,148 C1111F probably damaging Het
Zmym2 T A 14: 56,911,275 S349T probably damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 138066622 missense probably damaging 1.00
R6469:1110002E22Rik UTSW 3 138066975 missense probably damaging 0.97
R6499:1110002E22Rik UTSW 3 138068800 missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 138067527 missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 138066625 missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 138069154 missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 138066210 missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 138065169 nonsense probably null
R6920:1110002E22Rik UTSW 3 138068050 missense probably damaging 1.00
R7001:1110002E22Rik UTSW 3 138065511 missense probably benign
R7145:1110002E22Rik UTSW 3 138070059 missense probably damaging 1.00
R7238:1110002E22Rik UTSW 3 138069951 missense probably damaging 1.00
R7278:1110002E22Rik UTSW 3 138065476 missense probably benign
R7425:1110002E22Rik UTSW 3 138065695 missense probably benign 0.00
R7487:1110002E22Rik UTSW 3 138066868 missense probably damaging 1.00
R7557:1110002E22Rik UTSW 3 138068283 nonsense probably null
R7663:1110002E22Rik UTSW 3 138066126 missense probably damaging 0.98
R7743:1110002E22Rik UTSW 3 138068755 missense probably damaging 1.00
R7799:1110002E22Rik UTSW 3 138069601 missense probably benign 0.33
R8181:1110002E22Rik UTSW 3 138068395 missense probably damaging 0.99
R8264:1110002E22Rik UTSW 3 138067782 missense probably damaging 0.99
R8273:1110002E22Rik UTSW 3 138066450 missense probably benign
R8434:1110002E22Rik UTSW 3 138067260 missense probably damaging 0.97
R8530:1110002E22Rik UTSW 3 138068825 missense probably damaging 0.99
R8754:1110002E22Rik UTSW 3 138066037 missense probably benign
R8808:1110002E22Rik UTSW 3 138070113 missense probably benign 0.01
R8891:1110002E22Rik UTSW 3 138066759 nonsense probably null
R9026:1110002E22Rik UTSW 3 138065148 missense possibly damaging 0.53
R9177:1110002E22Rik UTSW 3 138069916 missense probably damaging 1.00
R9291:1110002E22Rik UTSW 3 138066703 missense probably benign 0.02
R9293:1110002E22Rik UTSW 3 138066078 missense possibly damaging 0.93
R9307:1110002E22Rik UTSW 3 138065422 missense probably benign 0.04
R9439:1110002E22Rik UTSW 3 138066287 missense probably benign 0.00
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGACCCCAGGAGACATC -3'
(R):5'- GTAGTCCACCAGCTCCTTTG -3'

Sequencing Primer
(F):5'- GATGACAATAGCTGTTACGTCAG -3'
(R):5'- AGCTCCTTTGCCCGGATG -3'
Posted On 2022-03-25