Incidental Mutation 'R9250:Ovch2'
ID 701487
Institutional Source Beutler Lab
Gene Symbol Ovch2
Ensembl Gene ENSMUSG00000048236
Gene Name ovochymase 2
Synonyms 9230106D23Rik
MMRRC Submission 068989-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9250 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 107380751-107400386 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 107392542 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 267 (R267L)
Ref Sequence ENSEMBL: ENSMUSP00000102366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106755]
AlphaFold Q7M761
Predicted Effect probably damaging
Transcript: ENSMUST00000106755
AA Change: R267L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102366
Gene: ENSMUSG00000048236
AA Change: R267L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Tryp_SPc 51 294 6.58e-93 SMART
CUB 314 421 1.68e-17 SMART
CUB 431 543 5.02e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C G 3: 137,772,389 (GRCm39) A526G probably damaging Het
AAdacl4fm3 A T 4: 144,442,011 (GRCm39) I80K probably benign Het
Ablim3 A G 18: 61,944,501 (GRCm39) L526P probably damaging Het
Aknad1 T C 3: 108,664,143 (GRCm39) S369P probably damaging Het
Aldh8a1 T C 10: 21,258,259 (GRCm39) S119P probably damaging Het
Brpf3 T C 17: 29,054,788 (GRCm39) I1110T probably damaging Het
Cdk12 T C 11: 98,101,398 (GRCm39) S419P probably benign Het
Cmklr1 G C 5: 113,752,043 (GRCm39) H319Q probably benign Het
Crim1 C T 17: 78,677,471 (GRCm39) H891Y probably benign Het
Dapp1 T C 3: 137,638,919 (GRCm39) E269G probably benign Het
Ddt T C 10: 75,609,063 (GRCm39) D32G probably benign Het
Dlg5 T C 14: 24,240,543 (GRCm39) D236G probably benign Het
Edem1 C A 6: 108,805,850 (GRCm39) D50E probably benign Het
Exoc5 A T 14: 49,256,915 (GRCm39) N490K probably damaging Het
Fam117a C A 11: 95,228,071 (GRCm39) D60E possibly damaging Het
Fam186a A G 15: 99,845,330 (GRCm39) S305P unknown Het
Fbxw21 A G 9: 108,972,846 (GRCm39) F363L probably benign Het
Fhl2 A G 1: 43,167,422 (GRCm39) C224R probably damaging Het
Gad1 T A 2: 70,409,543 (GRCm39) N211K probably damaging Het
Igdcc4 A G 9: 65,038,932 (GRCm39) T906A possibly damaging Het
Igkv3-5 T C 6: 70,640,758 (GRCm39) S80P probably benign Het
Igkv4-90 C A 6: 68,784,331 (GRCm39) G62* probably null Het
Il31ra A T 13: 112,669,508 (GRCm39) Y386N probably damaging Het
Kif13a G T 13: 46,928,909 (GRCm39) H1159N probably damaging Het
Kmt2a G A 9: 44,759,683 (GRCm39) S722F possibly damaging Het
Mipep T C 14: 61,028,358 (GRCm39) Y157H probably damaging Het
Mipol1 A G 12: 57,461,169 (GRCm39) E293G probably damaging Het
Mmp7 A T 9: 7,697,885 (GRCm39) probably benign Het
Mr1 A G 1: 155,013,325 (GRCm39) L84P probably damaging Het
Neb A G 2: 52,168,913 (GRCm39) V1874A possibly damaging Het
Nefm T C 14: 68,358,570 (GRCm39) probably benign Het
Nek1 T C 8: 61,465,151 (GRCm39) M80T probably damaging Het
Nubp2 A G 17: 25,103,373 (GRCm39) probably null Het
Or10ab4 C T 7: 107,655,014 (GRCm39) T275M probably damaging Het
Or5w11 T C 2: 87,459,278 (GRCm39) I41T probably benign Het
Or8b101 T A 9: 38,020,718 (GRCm39) C240* probably null Het
Pole A G 5: 110,447,687 (GRCm39) E741G possibly damaging Het
Ptprh T A 7: 4,576,289 (GRCm39) T324S probably benign Het
Pxk T A 14: 8,144,123 (GRCm38) H290Q probably damaging Het
Rab11fip3 G T 17: 26,237,219 (GRCm39) T5N unknown Het
Rp9 G A 9: 22,365,086 (GRCm39) Q124* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,121 (GRCm39) probably benign Het
Runx2 A G 17: 45,125,459 (GRCm39) L19P probably benign Het
Sf1 C T 19: 6,424,764 (GRCm39) P473L unknown Het
Slc9a2 C T 1: 40,806,987 (GRCm39) T758I probably benign Het
Spef1l C A 7: 139,556,395 (GRCm39) K197N probably benign Het
Tas2r105 T G 6: 131,663,951 (GRCm39) H159P probably benign Het
Tas2r120 T A 6: 132,633,954 (GRCm39) M12K probably benign Het
Thoc2l A G 5: 104,667,320 (GRCm39) Y614C probably benign Het
Trpv4 T C 5: 114,764,941 (GRCm39) Y691C probably damaging Het
Unc93a A G 17: 13,334,488 (GRCm39) V337A probably benign Het
Usp17le T G 7: 104,418,839 (GRCm39) Q101P probably damaging Het
Usp3 A T 9: 66,449,793 (GRCm39) probably null Het
Zfp445 T C 9: 122,681,092 (GRCm39) S950G possibly damaging Het
Zfp644 T G 5: 106,784,699 (GRCm39) D616A probably damaging Het
Zfp759 T G 13: 67,288,461 (GRCm39) C671G probably damaging Het
Zgrf1 G T 3: 127,379,797 (GRCm39) C1111F probably damaging Het
Zmym2 T A 14: 57,148,732 (GRCm39) S349T probably damaging Het
Other mutations in Ovch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Ovch2 APN 7 107,388,297 (GRCm39) missense probably null 1.00
IGL02198:Ovch2 APN 7 107,394,041 (GRCm39) missense probably damaging 0.99
IGL02200:Ovch2 APN 7 107,394,030 (GRCm39) missense probably damaging 1.00
IGL02442:Ovch2 APN 7 107,395,755 (GRCm39) missense possibly damaging 0.90
IGL02531:Ovch2 APN 7 107,389,405 (GRCm39) missense probably damaging 1.00
IGL02862:Ovch2 APN 7 107,394,138 (GRCm39) missense probably damaging 1.00
R0401:Ovch2 UTSW 7 107,400,343 (GRCm39) missense probably damaging 0.98
R0413:Ovch2 UTSW 7 107,381,243 (GRCm39) missense probably benign
R0631:Ovch2 UTSW 7 107,381,228 (GRCm39) missense probably benign 0.01
R1028:Ovch2 UTSW 7 107,395,755 (GRCm39) missense probably benign 0.37
R1329:Ovch2 UTSW 7 107,384,653 (GRCm39) missense probably damaging 1.00
R1809:Ovch2 UTSW 7 107,389,412 (GRCm39) critical splice acceptor site probably null
R2254:Ovch2 UTSW 7 107,389,402 (GRCm39) missense probably benign 0.02
R2265:Ovch2 UTSW 7 107,383,782 (GRCm39) missense probably damaging 1.00
R2358:Ovch2 UTSW 7 107,394,122 (GRCm39) missense probably damaging 1.00
R2922:Ovch2 UTSW 7 107,389,596 (GRCm39) missense possibly damaging 0.88
R2923:Ovch2 UTSW 7 107,389,596 (GRCm39) missense possibly damaging 0.88
R3034:Ovch2 UTSW 7 107,384,699 (GRCm39) missense probably damaging 1.00
R3885:Ovch2 UTSW 7 107,395,775 (GRCm39) missense probably damaging 1.00
R3957:Ovch2 UTSW 7 107,388,318 (GRCm39) missense probably damaging 0.99
R4687:Ovch2 UTSW 7 107,395,755 (GRCm39) missense possibly damaging 0.90
R5307:Ovch2 UTSW 7 107,391,341 (GRCm39) missense probably benign 0.26
R5353:Ovch2 UTSW 7 107,393,631 (GRCm39) missense probably damaging 0.98
R5688:Ovch2 UTSW 7 107,393,201 (GRCm39) missense probably damaging 1.00
R5730:Ovch2 UTSW 7 107,392,606 (GRCm39) missense probably damaging 1.00
R5767:Ovch2 UTSW 7 107,381,185 (GRCm39) missense probably benign
R5979:Ovch2 UTSW 7 107,393,595 (GRCm39) missense possibly damaging 0.94
R6039:Ovch2 UTSW 7 107,388,318 (GRCm39) missense probably damaging 0.99
R6039:Ovch2 UTSW 7 107,388,318 (GRCm39) missense probably damaging 0.99
R6064:Ovch2 UTSW 7 107,395,779 (GRCm39) missense probably damaging 0.98
R6247:Ovch2 UTSW 7 107,384,648 (GRCm39) missense probably damaging 1.00
R6638:Ovch2 UTSW 7 107,388,301 (GRCm39) missense probably benign 0.17
R6877:Ovch2 UTSW 7 107,389,315 (GRCm39) missense probably benign 0.25
R7040:Ovch2 UTSW 7 107,395,772 (GRCm39) missense probably damaging 1.00
R7257:Ovch2 UTSW 7 107,393,640 (GRCm39) missense probably damaging 1.00
R7282:Ovch2 UTSW 7 107,393,577 (GRCm39) missense possibly damaging 0.94
R7824:Ovch2 UTSW 7 107,388,295 (GRCm39) critical splice donor site probably null
R7841:Ovch2 UTSW 7 107,393,298 (GRCm39) missense probably benign 0.01
R7908:Ovch2 UTSW 7 107,388,326 (GRCm39) missense probably damaging 1.00
R8427:Ovch2 UTSW 7 107,393,207 (GRCm39) missense probably damaging 1.00
R8745:Ovch2 UTSW 7 107,389,584 (GRCm39) missense possibly damaging 0.93
R8812:Ovch2 UTSW 7 107,393,251 (GRCm39) nonsense probably null
R8812:Ovch2 UTSW 7 107,392,462 (GRCm39) missense probably damaging 1.00
R9301:Ovch2 UTSW 7 107,395,815 (GRCm39) missense probably damaging 1.00
R9308:Ovch2 UTSW 7 107,389,560 (GRCm39) missense probably benign 0.03
R9703:Ovch2 UTSW 7 107,383,777 (GRCm39) missense probably damaging 1.00
R9717:Ovch2 UTSW 7 107,393,584 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGATTGTCTAGTCTGCTAATGC -3'
(R):5'- CCCAGACCCCTGAGTCTTAATTG -3'

Sequencing Primer
(F):5'- GCTCTTTACCCCGGTAGAACTGTAG -3'
(R):5'- CCCCTGAGTCTTAATTGTTAGAAGTG -3'
Posted On 2022-03-25