Incidental Mutation 'R9250:Ovch2'
ID 701487
Institutional Source Beutler Lab
Gene Symbol Ovch2
Ensembl Gene ENSMUSG00000048236
Gene Name ovochymase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9250 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 107781544-107801208 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 107793335 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 267 (R267L)
Ref Sequence ENSEMBL: ENSMUSP00000102366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106755]
AlphaFold Q7M761
Predicted Effect probably damaging
Transcript: ENSMUST00000106755
AA Change: R267L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102366
Gene: ENSMUSG00000048236
AA Change: R267L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Tryp_SPc 51 294 6.58e-93 SMART
CUB 314 421 1.68e-17 SMART
CUB 431 543 5.02e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C G 3: 138,066,628 A526G probably damaging Het
6430531B16Rik C A 7: 139,976,482 K197N probably benign Het
Ablim3 A G 18: 61,811,430 L526P probably damaging Het
Aknad1 T C 3: 108,756,827 S369P probably damaging Het
Aldh8a1 T C 10: 21,382,360 S119P probably damaging Het
BC005561 A G 5: 104,519,454 Y614C probably benign Het
Brpf3 T C 17: 28,835,814 I1110T probably damaging Het
Cdk12 T C 11: 98,210,572 S419P probably benign Het
Cmklr1 G C 5: 113,613,982 H319Q probably benign Het
Crim1 C T 17: 78,370,042 H891Y probably benign Het
Dapp1 T C 3: 137,933,158 E269G probably benign Het
Ddt T C 10: 75,773,229 D32G probably benign Het
Dlg5 T C 14: 24,190,475 D236G probably benign Het
Edem1 C A 6: 108,828,889 D50E probably benign Het
Exoc5 A T 14: 49,019,458 N490K probably damaging Het
Fam117a C A 11: 95,337,245 D60E possibly damaging Het
Fam186a A G 15: 99,947,449 S305P unknown Het
Fbxw21 A G 9: 109,143,778 F363L probably benign Het
Fhl2 A G 1: 43,128,262 C224R probably damaging Het
Gad1 T A 2: 70,579,199 N211K probably damaging Het
Gm13178 A T 4: 144,715,441 I80K probably benign Het
Igdcc4 A G 9: 65,131,650 T906A possibly damaging Het
Igkv3-5 T C 6: 70,663,774 S80P probably benign Het
Igkv4-90 C A 6: 68,807,347 G62* probably null Het
Il31ra A T 13: 112,532,974 Y386N probably damaging Het
Kif13a G T 13: 46,775,433 H1159N probably damaging Het
Kmt2a G A 9: 44,848,386 S722F possibly damaging Het
Mipep T C 14: 60,790,909 Y157H probably damaging Het
Mipol1 A G 12: 57,414,383 E293G probably damaging Het
Mmp7 A T 9: 7,697,884 probably benign Het
Mr1 A G 1: 155,137,579 L84P probably damaging Het
Neb A G 2: 52,278,901 V1874A possibly damaging Het
Nefm T C 14: 68,121,121 probably benign Het
Nek1 T C 8: 61,012,117 M80T probably damaging Het
Nubp2 A G 17: 24,884,399 probably null Het
Olfr1131 T C 2: 87,628,934 I41T probably benign Het
Olfr479 C T 7: 108,055,807 T275M probably damaging Het
Olfr888 T A 9: 38,109,422 C240* probably null Het
Pole A G 5: 110,299,821 E741G possibly damaging Het
Ptprh T A 7: 4,573,290 T324S probably benign Het
Pxk T A 14: 8,144,123 H290Q probably damaging Het
Rab11fip3 G T 17: 26,018,245 T5N unknown Het
Rp9 G A 9: 22,453,790 Q124* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Runx2 A G 17: 44,814,572 L19P probably benign Het
Sf1 C T 19: 6,374,734 P473L unknown Het
Slc9a2 C T 1: 40,767,827 T758I probably benign Het
Tas2r105 T G 6: 131,686,988 H159P probably benign Het
Tas2r120 T A 6: 132,656,991 M12K probably benign Het
Trpv4 T C 5: 114,626,880 Y691C probably damaging Het
Unc93a A G 17: 13,115,601 V337A probably benign Het
Usp17le T G 7: 104,769,632 Q101P probably damaging Het
Usp3 A T 9: 66,542,511 probably null Het
Zfp445 T C 9: 122,852,027 S950G possibly damaging Het
Zfp644 T G 5: 106,636,833 D616A probably damaging Het
Zfp759 T G 13: 67,140,397 C671G probably damaging Het
Zgrf1 G T 3: 127,586,148 C1111F probably damaging Het
Zmym2 T A 14: 56,911,275 S349T probably damaging Het
Other mutations in Ovch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Ovch2 APN 7 107789090 missense probably null 1.00
IGL02198:Ovch2 APN 7 107794834 missense probably damaging 0.99
IGL02200:Ovch2 APN 7 107794823 missense probably damaging 1.00
IGL02442:Ovch2 APN 7 107796548 missense possibly damaging 0.90
IGL02531:Ovch2 APN 7 107790198 missense probably damaging 1.00
IGL02862:Ovch2 APN 7 107794931 missense probably damaging 1.00
R0401:Ovch2 UTSW 7 107801136 missense probably damaging 0.98
R0413:Ovch2 UTSW 7 107782036 missense probably benign
R0631:Ovch2 UTSW 7 107782021 missense probably benign 0.01
R1028:Ovch2 UTSW 7 107796548 missense probably benign 0.37
R1329:Ovch2 UTSW 7 107785446 missense probably damaging 1.00
R1809:Ovch2 UTSW 7 107790205 critical splice acceptor site probably null
R2254:Ovch2 UTSW 7 107790195 missense probably benign 0.02
R2265:Ovch2 UTSW 7 107784575 missense probably damaging 1.00
R2358:Ovch2 UTSW 7 107794915 missense probably damaging 1.00
R2922:Ovch2 UTSW 7 107790389 missense possibly damaging 0.88
R2923:Ovch2 UTSW 7 107790389 missense possibly damaging 0.88
R3034:Ovch2 UTSW 7 107785492 missense probably damaging 1.00
R3885:Ovch2 UTSW 7 107796568 missense probably damaging 1.00
R3957:Ovch2 UTSW 7 107789111 missense probably damaging 0.99
R4687:Ovch2 UTSW 7 107796548 missense possibly damaging 0.90
R5307:Ovch2 UTSW 7 107792134 missense probably benign 0.26
R5353:Ovch2 UTSW 7 107794424 missense probably damaging 0.98
R5688:Ovch2 UTSW 7 107793994 missense probably damaging 1.00
R5730:Ovch2 UTSW 7 107793399 missense probably damaging 1.00
R5767:Ovch2 UTSW 7 107781978 missense probably benign
R5979:Ovch2 UTSW 7 107794388 missense possibly damaging 0.94
R6039:Ovch2 UTSW 7 107789111 missense probably damaging 0.99
R6039:Ovch2 UTSW 7 107789111 missense probably damaging 0.99
R6064:Ovch2 UTSW 7 107796572 missense probably damaging 0.98
R6247:Ovch2 UTSW 7 107785441 missense probably damaging 1.00
R6638:Ovch2 UTSW 7 107789094 missense probably benign 0.17
R6877:Ovch2 UTSW 7 107790108 missense probably benign 0.25
R7040:Ovch2 UTSW 7 107796565 missense probably damaging 1.00
R7257:Ovch2 UTSW 7 107794433 missense probably damaging 1.00
R7282:Ovch2 UTSW 7 107794370 missense possibly damaging 0.94
R7824:Ovch2 UTSW 7 107789088 critical splice donor site probably null
R7841:Ovch2 UTSW 7 107794091 missense probably benign 0.01
R7908:Ovch2 UTSW 7 107789119 missense probably damaging 1.00
R8427:Ovch2 UTSW 7 107794000 missense probably damaging 1.00
R8745:Ovch2 UTSW 7 107790377 missense possibly damaging 0.93
R8812:Ovch2 UTSW 7 107793255 missense probably damaging 1.00
R8812:Ovch2 UTSW 7 107794044 nonsense probably null
R9301:Ovch2 UTSW 7 107796608 missense probably damaging 1.00
R9308:Ovch2 UTSW 7 107790353 missense probably benign 0.03
R9703:Ovch2 UTSW 7 107784570 missense probably damaging 1.00
R9717:Ovch2 UTSW 7 107794377 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGATTGTCTAGTCTGCTAATGC -3'
(R):5'- CCCAGACCCCTGAGTCTTAATTG -3'

Sequencing Primer
(F):5'- GCTCTTTACCCCGGTAGAACTGTAG -3'
(R):5'- CCCCTGAGTCTTAATTGTTAGAAGTG -3'
Posted On 2022-03-25