Incidental Mutation 'R9250:Mipol1'
ID 701502
Institutional Source Beutler Lab
Gene Symbol Mipol1
Ensembl Gene ENSMUSG00000047022
Gene Name mirror-image polydactyly 1
Synonyms 1700081O04Rik, 6030439O22Rik, D12Ertd19e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9250 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 57230427-57497199 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 57414383 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 293 (E293G)
Ref Sequence ENSEMBL: ENSMUSP00000121617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123498] [ENSMUST00000130447] [ENSMUST00000145003] [ENSMUST00000153137]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000123498
AA Change: E293G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119636
Gene: ENSMUSG00000047022
AA Change: E293G

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000130447
AA Change: E293G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119918
Gene: ENSMUSG00000047022
AA Change: E293G

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000145003
AA Change: E293G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121617
Gene: ENSMUSG00000047022
AA Change: E293G

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000153137
AA Change: E293G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117005
Gene: ENSMUSG00000047022
AA Change: E293G

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein may function as a tumor suppressor. A translocation that results in truncation of the protein encoded by this locus has been associated with mirror-image polydactyly, also known as Laurin-Sandrow Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C G 3: 138,066,628 A526G probably damaging Het
6430531B16Rik C A 7: 139,976,482 K197N probably benign Het
Ablim3 A G 18: 61,811,430 L526P probably damaging Het
Aknad1 T C 3: 108,756,827 S369P probably damaging Het
Aldh8a1 T C 10: 21,382,360 S119P probably damaging Het
BC005561 A G 5: 104,519,454 Y614C probably benign Het
Brpf3 T C 17: 28,835,814 I1110T probably damaging Het
Cdk12 T C 11: 98,210,572 S419P probably benign Het
Cmklr1 G C 5: 113,613,982 H319Q probably benign Het
Crim1 C T 17: 78,370,042 H891Y probably benign Het
Dapp1 T C 3: 137,933,158 E269G probably benign Het
Ddt T C 10: 75,773,229 D32G probably benign Het
Dlg5 T C 14: 24,190,475 D236G probably benign Het
Edem1 C A 6: 108,828,889 D50E probably benign Het
Exoc5 A T 14: 49,019,458 N490K probably damaging Het
Fam117a C A 11: 95,337,245 D60E possibly damaging Het
Fam186a A G 15: 99,947,449 S305P unknown Het
Fbxw21 A G 9: 109,143,778 F363L probably benign Het
Fhl2 A G 1: 43,128,262 C224R probably damaging Het
Gad1 T A 2: 70,579,199 N211K probably damaging Het
Gm13178 A T 4: 144,715,441 I80K probably benign Het
Igdcc4 A G 9: 65,131,650 T906A possibly damaging Het
Igkv3-5 T C 6: 70,663,774 S80P probably benign Het
Igkv4-90 C A 6: 68,807,347 G62* probably null Het
Il31ra A T 13: 112,532,974 Y386N probably damaging Het
Kif13a G T 13: 46,775,433 H1159N probably damaging Het
Kmt2a G A 9: 44,848,386 S722F possibly damaging Het
Mipep T C 14: 60,790,909 Y157H probably damaging Het
Mr1 A G 1: 155,137,579 L84P probably damaging Het
Neb A G 2: 52,278,901 V1874A possibly damaging Het
Nefm T C 14: 68,121,121 probably benign Het
Nek1 T C 8: 61,012,117 M80T probably damaging Het
Nubp2 A G 17: 24,884,399 probably null Het
Olfr1131 T C 2: 87,628,934 I41T probably benign Het
Olfr479 C T 7: 108,055,807 T275M probably damaging Het
Olfr888 T A 9: 38,109,422 C240* probably null Het
Ovch2 C A 7: 107,793,335 R267L probably damaging Het
Pole A G 5: 110,299,821 E741G possibly damaging Het
Ptprh T A 7: 4,573,290 T324S probably benign Het
Pxk T A 14: 8,144,123 H290Q probably damaging Het
Rab11fip3 G T 17: 26,018,245 T5N unknown Het
Rp9 G A 9: 22,453,790 Q124* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Runx2 A G 17: 44,814,572 L19P probably benign Het
Sf1 C T 19: 6,374,734 P473L unknown Het
Slc9a2 C T 1: 40,767,827 T758I probably benign Het
Tas2r105 T G 6: 131,686,988 H159P probably benign Het
Tas2r120 T A 6: 132,656,991 M12K probably benign Het
Trpv4 T C 5: 114,626,880 Y691C probably damaging Het
Unc93a A G 17: 13,115,601 V337A probably benign Het
Usp17le T G 7: 104,769,632 Q101P probably damaging Het
Usp3 A T 9: 66,542,511 probably null Het
Zfp445 T C 9: 122,852,027 S950G possibly damaging Het
Zfp644 T G 5: 106,636,833 D616A probably damaging Het
Zfp759 T G 13: 67,140,397 C671G probably damaging Het
Zgrf1 G T 3: 127,586,148 C1111F probably damaging Het
Zmym2 T A 14: 56,911,275 S349T probably damaging Het
Other mutations in Mipol1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Mipol1 APN 12 57307353 splice site probably benign
IGL01139:Mipol1 APN 12 57306035 nonsense probably null
IGL02679:Mipol1 APN 12 57306043 missense possibly damaging 0.84
IGL03109:Mipol1 APN 12 57364224 missense probably benign 0.20
R0001:Mipol1 UTSW 12 57460839 splice site probably benign
R0220:Mipol1 UTSW 12 57457150 missense probably damaging 1.00
R0271:Mipol1 UTSW 12 57460954 unclassified probably benign
R0284:Mipol1 UTSW 12 57457069 missense probably damaging 0.98
R0496:Mipol1 UTSW 12 57457177 missense probably damaging 0.99
R0538:Mipol1 UTSW 12 57414411 critical splice donor site probably null
R1082:Mipol1 UTSW 12 57325616 missense probably damaging 0.98
R1552:Mipol1 UTSW 12 57306088 missense possibly damaging 0.86
R1558:Mipol1 UTSW 12 57332341 missense probably damaging 1.00
R1928:Mipol1 UTSW 12 57332419 missense probably damaging 1.00
R2104:Mipol1 UTSW 12 57306056 splice site probably null
R2495:Mipol1 UTSW 12 57460990 splice site probably benign
R3723:Mipol1 UTSW 12 57457092 missense probably damaging 1.00
R4431:Mipol1 UTSW 12 57303524 missense possibly damaging 0.58
R4447:Mipol1 UTSW 12 57352748 intron probably benign
R4654:Mipol1 UTSW 12 57306132 missense probably benign 0.22
R4847:Mipol1 UTSW 12 57303496 missense probably damaging 0.99
R4851:Mipol1 UTSW 12 57332301 missense probably damaging 1.00
R5113:Mipol1 UTSW 12 57496499 missense probably benign 0.36
R5668:Mipol1 UTSW 12 57325560 missense possibly damaging 0.48
R6535:Mipol1 UTSW 12 57306100 missense possibly damaging 0.95
R7172:Mipol1 UTSW 12 57325535 missense possibly damaging 0.95
R7191:Mipol1 UTSW 12 57457066 missense probably benign 0.01
R7560:Mipol1 UTSW 12 57306073 missense possibly damaging 0.94
R8508:Mipol1 UTSW 12 57306088 missense possibly damaging 0.86
R8752:Mipol1 UTSW 12 57325581 missense probably damaging 1.00
R8772:Mipol1 UTSW 12 57325632 missense probably benign 0.23
R8861:Mipol1 UTSW 12 57306016 missense probably benign 0.00
R8928:Mipol1 UTSW 12 57460865 missense probably benign 0.00
R9011:Mipol1 UTSW 12 57457079 missense probably benign 0.03
R9383:Mipol1 UTSW 12 57306034 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGCAGTTTAGTAACTAGCCACGTG -3'
(R):5'- CTTCAACTAACCAGATGTCACTTAG -3'

Sequencing Primer
(F):5'- AGTTTAGTAACTAGCCACGTGAGTAC -3'
(R):5'- AACACCAGGTACAGGAGT -3'
Posted On 2022-03-25