Incidental Mutation 'R9250:Fam186a'
ID 701512
Institutional Source Beutler Lab
Gene Symbol Fam186a
Ensembl Gene ENSMUSG00000045350
Gene Name family with sequence similarity 186, member A
Synonyms LOC380973, 1700030F18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R9250 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 99918348-99967061 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 99947449 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 305 (S305P)
Ref Sequence ENSEMBL: ENSMUSP00000097783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100209]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000100209
AA Change: S305P
SMART Domains Protein: ENSMUSP00000097783
Gene: ENSMUSG00000045350
AA Change: S305P

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:FBG 44 222 4e-48 BLAST
coiled coil region 292 340 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 446 458 N/A INTRINSIC
low complexity region 632 644 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
internal_repeat_2 743 1156 1.05e-58 PROSPERO
internal_repeat_1 833 1270 7.71e-59 PROSPERO
low complexity region 1271 1285 N/A INTRINSIC
low complexity region 1289 1300 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1327 1338 N/A INTRINSIC
low complexity region 1347 1361 N/A INTRINSIC
low complexity region 1365 1376 N/A INTRINSIC
low complexity region 1384 1395 N/A INTRINSIC
low complexity region 1403 1414 N/A INTRINSIC
low complexity region 1423 1437 N/A INTRINSIC
low complexity region 1441 1452 N/A INTRINSIC
low complexity region 1460 1471 N/A INTRINSIC
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1498 1509 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1536 1547 N/A INTRINSIC
low complexity region 1555 1566 N/A INTRINSIC
low complexity region 1574 1585 N/A INTRINSIC
internal_repeat_1 1586 1981 7.71e-59 PROSPERO
internal_repeat_2 1737 2197 1.05e-58 PROSPERO
low complexity region 2367 2378 N/A INTRINSIC
low complexity region 2549 2564 N/A INTRINSIC
low complexity region 2644 2655 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C G 3: 138,066,628 A526G probably damaging Het
6430531B16Rik C A 7: 139,976,482 K197N probably benign Het
Ablim3 A G 18: 61,811,430 L526P probably damaging Het
Aknad1 T C 3: 108,756,827 S369P probably damaging Het
Aldh8a1 T C 10: 21,382,360 S119P probably damaging Het
BC005561 A G 5: 104,519,454 Y614C probably benign Het
Brpf3 T C 17: 28,835,814 I1110T probably damaging Het
Cdk12 T C 11: 98,210,572 S419P probably benign Het
Cmklr1 G C 5: 113,613,982 H319Q probably benign Het
Crim1 C T 17: 78,370,042 H891Y probably benign Het
Dapp1 T C 3: 137,933,158 E269G probably benign Het
Ddt T C 10: 75,773,229 D32G probably benign Het
Dlg5 T C 14: 24,190,475 D236G probably benign Het
Edem1 C A 6: 108,828,889 D50E probably benign Het
Exoc5 A T 14: 49,019,458 N490K probably damaging Het
Fam117a C A 11: 95,337,245 D60E possibly damaging Het
Fbxw21 A G 9: 109,143,778 F363L probably benign Het
Fhl2 A G 1: 43,128,262 C224R probably damaging Het
Gad1 T A 2: 70,579,199 N211K probably damaging Het
Gm13178 A T 4: 144,715,441 I80K probably benign Het
Igdcc4 A G 9: 65,131,650 T906A possibly damaging Het
Igkv3-5 T C 6: 70,663,774 S80P probably benign Het
Igkv4-90 C A 6: 68,807,347 G62* probably null Het
Il31ra A T 13: 112,532,974 Y386N probably damaging Het
Kif13a G T 13: 46,775,433 H1159N probably damaging Het
Kmt2a G A 9: 44,848,386 S722F possibly damaging Het
Mipep T C 14: 60,790,909 Y157H probably damaging Het
Mipol1 A G 12: 57,414,383 E293G probably damaging Het
Mr1 A G 1: 155,137,579 L84P probably damaging Het
Neb A G 2: 52,278,901 V1874A possibly damaging Het
Nefm T C 14: 68,121,121 probably benign Het
Nek1 T C 8: 61,012,117 M80T probably damaging Het
Nubp2 A G 17: 24,884,399 probably null Het
Olfr1131 T C 2: 87,628,934 I41T probably benign Het
Olfr479 C T 7: 108,055,807 T275M probably damaging Het
Olfr888 T A 9: 38,109,422 C240* probably null Het
Ovch2 C A 7: 107,793,335 R267L probably damaging Het
Pole A G 5: 110,299,821 E741G possibly damaging Het
Ptprh T A 7: 4,573,290 T324S probably benign Het
Pxk T A 14: 8,144,123 H290Q probably damaging Het
Rab11fip3 G T 17: 26,018,245 T5N unknown Het
Rp9 G A 9: 22,453,790 Q124* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Runx2 A G 17: 44,814,572 L19P probably benign Het
Sf1 C T 19: 6,374,734 P473L unknown Het
Slc9a2 C T 1: 40,767,827 T758I probably benign Het
Tas2r105 T G 6: 131,686,988 H159P probably benign Het
Tas2r120 T A 6: 132,656,991 M12K probably benign Het
Trpv4 T C 5: 114,626,880 Y691C probably damaging Het
Unc93a A G 17: 13,115,601 V337A probably benign Het
Usp17le T G 7: 104,769,632 Q101P probably damaging Het
Usp3 A T 9: 66,542,511 probably null Het
Zfp445 T C 9: 122,852,027 S950G possibly damaging Het
Zfp644 T G 5: 106,636,833 D616A probably damaging Het
Zfp759 T G 13: 67,140,397 C671G probably damaging Het
Zgrf1 G T 3: 127,586,148 C1111F probably damaging Het
Zmym2 T A 14: 56,911,275 S349T probably damaging Het
Other mutations in Fam186a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Fam186a APN 15 99927691 splice site probably benign
IGL03047:Fam186a UTSW 15 99945708 missense unknown
R0172:Fam186a UTSW 15 99954887 missense unknown
R0194:Fam186a UTSW 15 99941763 missense possibly damaging 0.92
R0381:Fam186a UTSW 15 99942174 missense probably damaging 0.97
R0799:Fam186a UTSW 15 99942012 missense probably damaging 1.00
R1295:Fam186a UTSW 15 99939789 splice site probably benign
R1366:Fam186a UTSW 15 99943389 missense possibly damaging 0.89
R1519:Fam186a UTSW 15 99947655 missense unknown
R1592:Fam186a UTSW 15 99940318 missense probably benign 0.01
R1636:Fam186a UTSW 15 99941658 missense unknown
R1719:Fam186a UTSW 15 99942346 missense possibly damaging 0.54
R1759:Fam186a UTSW 15 99966881 nonsense probably null
R1856:Fam186a UTSW 15 99940302 missense possibly damaging 0.82
R2131:Fam186a UTSW 15 99933676 unclassified probably benign
R2192:Fam186a UTSW 15 99940311 missense possibly damaging 0.90
R2239:Fam186a UTSW 15 99954864 missense unknown
R2251:Fam186a UTSW 15 99945097 missense probably benign 0.02
R2902:Fam186a UTSW 15 99945168 missense possibly damaging 0.73
R3037:Fam186a UTSW 15 99943794 missense probably damaging 0.99
R3744:Fam186a UTSW 15 99947535 missense unknown
R4021:Fam186a UTSW 15 99941799 missense possibly damaging 0.66
R4183:Fam186a UTSW 15 99933685 unclassified probably benign
R4238:Fam186a UTSW 15 99943642 missense probably benign 0.05
R4667:Fam186a UTSW 15 99944532 missense possibly damaging 0.92
R4817:Fam186a UTSW 15 99933538 unclassified probably benign
R4835:Fam186a UTSW 15 99945808 missense unknown
R4837:Fam186a UTSW 15 99940797 missense unknown
R4897:Fam186a UTSW 15 99945277 missense possibly damaging 0.66
R4902:Fam186a UTSW 15 99946842 missense unknown
R4950:Fam186a UTSW 15 99941653 missense unknown
R4995:Fam186a UTSW 15 99945099 missense probably benign 0.27
R5062:Fam186a UTSW 15 99944646 missense possibly damaging 0.66
R5124:Fam186a UTSW 15 99943096 missense possibly damaging 0.90
R5133:Fam186a UTSW 15 99955493 missense unknown
R5424:Fam186a UTSW 15 99945763 missense unknown
R5624:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5628:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5637:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5639:Fam186a UTSW 15 99947050 missense unknown
R5652:Fam186a UTSW 15 99945372 missense possibly damaging 0.79
R5673:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5799:Fam186a UTSW 15 99966824 nonsense probably null
R5965:Fam186a UTSW 15 99945097 missense probably benign 0.37
R6044:Fam186a UTSW 15 99941997 missense probably damaging 0.97
R6077:Fam186a UTSW 15 99942703 missense possibly damaging 0.46
R6120:Fam186a UTSW 15 99940363 missense probably benign 0.00
R6185:Fam186a UTSW 15 99947649 missense unknown
R6186:Fam186a UTSW 15 99947325 missense unknown
R6242:Fam186a UTSW 15 99939907 missense unknown
R6351:Fam186a UTSW 15 99941742 missense probably damaging 0.97
R6368:Fam186a UTSW 15 99943317 missense possibly damaging 0.66
R6369:Fam186a UTSW 15 99947331 missense unknown
R6559:Fam186a UTSW 15 99944475 missense possibly damaging 0.46
R6855:Fam186a UTSW 15 99954875 missense unknown
R6867:Fam186a UTSW 15 99945850 missense unknown
R6957:Fam186a UTSW 15 99946476 missense unknown
R6961:Fam186a UTSW 15 99940201 missense probably benign 0.16
R6994:Fam186a UTSW 15 99942466 missense probably benign 0.35
R6996:Fam186a UTSW 15 99955493 missense unknown
R7062:Fam186a UTSW 15 99933640 unclassified probably benign
R7064:Fam186a UTSW 15 99941676 missense unknown
R7173:Fam186a UTSW 15 99945650 missense unknown
R7244:Fam186a UTSW 15 99946392 missense unknown
R7270:Fam186a UTSW 15 99944152 missense possibly damaging 0.66
R7410:Fam186a UTSW 15 99946945 nonsense probably null
R7437:Fam186a UTSW 15 99942894 missense probably damaging 1.00
R7475:Fam186a UTSW 15 99947514 missense unknown
R7487:Fam186a UTSW 15 99942136 missense possibly damaging 0.66
R7526:Fam186a UTSW 15 99941915 missense possibly damaging 0.83
R7650:Fam186a UTSW 15 99939907 missense unknown
R7658:Fam186a UTSW 15 99939844 missense unknown
R7663:Fam186a UTSW 15 99945069 missense probably benign 0.00
R7703:Fam186a UTSW 15 99954797 missense unknown
R7814:Fam186a UTSW 15 99944664 missense possibly damaging 0.92
R7958:Fam186a UTSW 15 99943308 missense probably damaging 0.99
R7970:Fam186a UTSW 15 99933586 missense unknown
R8076:Fam186a UTSW 15 99943470 missense possibly damaging 0.83
R8087:Fam186a UTSW 15 99941844 missense possibly damaging 0.46
R8130:Fam186a UTSW 15 99944033 frame shift probably null
R8239:Fam186a UTSW 15 99941310 missense unknown
R8246:Fam186a UTSW 15 99940547 missense unknown
R8446:Fam186a UTSW 15 99947454 missense unknown
R8469:Fam186a UTSW 15 99947305 missense unknown
R8676:Fam186a UTSW 15 99947142 missense unknown
R8790:Fam186a UTSW 15 99943143 missense possibly damaging 0.90
R8808:Fam186a UTSW 15 99944723 missense possibly damaging 0.83
R8848:Fam186a UTSW 15 99940153 missense possibly damaging 0.83
R9083:Fam186a UTSW 15 99945198 missense probably benign 0.27
R9106:Fam186a UTSW 15 99946226 small deletion probably benign
R9116:Fam186a UTSW 15 99942591 missense possibly damaging 0.95
R9156:Fam186a UTSW 15 99943278 missense possibly damaging 0.46
R9227:Fam186a UTSW 15 99955503 missense unknown
R9282:Fam186a UTSW 15 99941998 missense probably damaging 0.97
R9495:Fam186a UTSW 15 99946885 missense unknown
R9514:Fam186a UTSW 15 99946885 missense unknown
R9521:Fam186a UTSW 15 99943590 missense probably damaging 0.97
R9553:Fam186a UTSW 15 99946680 missense not run
X0021:Fam186a UTSW 15 99945435 missense probably benign 0.00
Z1088:Fam186a UTSW 15 99945994 missense unknown
Predicted Primers PCR Primer
(F):5'- AAAACGGCCCCTGTAAAGG -3'
(R):5'- TTGACCAGATCGGCTTAAACG -3'

Sequencing Primer
(F):5'- GGCAGTATTTTCAAGGACCCAGC -3'
(R):5'- CGGCTTAAACGCTAAGGTTTCAG -3'
Posted On 2022-03-25