Incidental Mutation 'R9251:Utrn'
ID 701559
Institutional Source Beutler Lab
Gene Symbol Utrn
Ensembl Gene ENSMUSG00000019820
Gene Name utrophin
Synonyms G-utrophin, DRP, Dmdl
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9251 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 12382188-12869365 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 12636787 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 2313 (T2313A)
Ref Sequence ENSEMBL: ENSMUSP00000076093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076817] [ENSMUST00000218635]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000076817
AA Change: T2313A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000076093
Gene: ENSMUSG00000019820
AA Change: T2313A

DomainStartEndE-ValueType
CH 33 133 1.87e-24 SMART
CH 152 250 4.05e-20 SMART
SPEC 312 416 2.31e-18 SMART
SPEC 421 525 4.18e-16 SMART
SPEC 532 636 3.35e-6 SMART
low complexity region 665 679 N/A INTRINSIC
SPEC 690 795 1.7e-7 SMART
SPEC 801 901 1e-4 SMART
SPEC 910 1012 8.24e-2 SMART
SPEC 1019 1121 1.32e-4 SMART
SPEC 1128 1229 2.64e-4 SMART
SPEC 1236 1333 4.42e-6 SMART
coiled coil region 1375 1401 N/A INTRINSIC
SPEC 1438 1540 3.62e-2 SMART
SPEC 1547 1648 7.95e-1 SMART
SPEC 1655 1752 3.56e0 SMART
coiled coil region 1766 1795 N/A INTRINSIC
SPEC 1870 1972 3.63e0 SMART
SPEC 1979 2080 5.15e-16 SMART
SPEC 2087 2183 3.71e0 SMART
SPEC 2227 2330 4.7e-10 SMART
SPEC 2337 2437 1.02e0 SMART
SPEC 2444 2553 2.35e-10 SMART
SPEC 2560 2685 8.77e-10 SMART
SPEC 2692 2794 4.13e-6 SMART
WW 2811 2843 5.59e-7 SMART
Pfam:EF-hand_2 2844 2962 3.8e-41 PFAM
Pfam:EF-hand_3 2966 3057 1.6e-39 PFAM
ZnF_ZZ 3062 3107 6.33e-17 SMART
coiled coil region 3250 3289 N/A INTRINSIC
coiled coil region 3310 3354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218635
AA Change: T2313A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene shares both structural and functional similarities with the dystrophin gene. It contains an actin-binding N-terminus, a triple coiled-coil repeat central region, and a C-terminus that consists of protein-protein interaction motifs which interact with dystroglycan protein components. The protein encoded by this gene is located at the neuromuscular synapse and myotendinous junctions, where it participates in post-synaptic membrane maintenance and acetylcholine receptor clustering. Mouse studies suggest that this gene may serve as a functional substitute for the dystrophin gene and therefore, may serve as a potential therapeutic alternative to muscular dystrophy which is caused by mutations in the dystrophin gene. Alternative splicing of the utrophin gene has been described; however, the full-length nature of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have reduced density of acetylcholine receptors and reduced number of junctional folds at neuromuscular junctions. Mice homozygous for utrophin and dystrophin knockouts die prematurely with severe, progressive muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap31 G T 16: 38,602,856 N949K probably benign Het
Arv1 T A 8: 124,725,323 I76N probably damaging Het
Cfap44 G A 16: 44,408,913 A189T probably damaging Het
Ch25h T C 19: 34,474,369 Y253C probably damaging Het
Cnot11 T C 1: 39,542,506 M376T probably damaging Het
Cnot7 T C 8: 40,511,581 probably benign Het
Dnah17 G A 11: 118,121,792 S481F probably benign Het
Dnah2 C T 11: 69,515,793 R541Q probably damaging Het
Dnah7a C T 1: 53,582,512 M1151I probably damaging Het
Dpf2 T C 19: 5,907,138 D19G probably damaging Het
Eefsec A T 6: 88,355,592 M212K probably damaging Het
Elp6 G A 9: 110,305,598 V12I unknown Het
Enox1 G A 14: 77,615,557 probably null Het
Epha1 G T 6: 42,364,843 N424K probably damaging Het
Fam171a1 T C 2: 3,225,488 S553P probably benign Het
Fbxw21 A G 9: 109,145,619 S278P probably damaging Het
Gm45861 T C 8: 27,542,561 probably null Het
Gm4846 T A 1: 166,483,738 R517S probably benign Het
Gnrhr A G 5: 86,197,362 L155P possibly damaging Het
Igfn1 C T 1: 135,966,671 probably benign Het
Ik T A 18: 36,747,442 probably null Het
Insrr A T 3: 87,810,084 Q763L probably benign Het
Klf5 G T 14: 99,301,388 C79F possibly damaging Het
Lrrcc1 A T 3: 14,558,394 R760S probably damaging Het
Map3k7 T A 4: 32,002,080 probably benign Het
Mapkbp1 C T 2: 120,023,190 A1159V probably benign Het
Mgst3 C T 1: 167,378,291 probably null Het
Mtch2 T A 2: 90,849,636 F71I probably damaging Het
Myo1e A G 9: 70,368,794 I764V probably benign Het
Myo3b T A 2: 70,258,081 L896* probably null Het
Ndufs5 T G 4: 123,712,835 E103A probably benign Het
Nfe2l1 G A 11: 96,819,595 P603S probably damaging Het
Olfr801 T A 10: 129,670,111 N136I possibly damaging Het
Olfr954 A T 9: 39,462,372 M311L probably benign Het
Piezo1 T C 8: 122,492,615 N1093S Het
Pitpnb G A 5: 111,385,524 R258H probably benign Het
Pla2g4d T C 2: 120,268,897 E708G possibly damaging Het
Plppr4 T A 3: 117,321,959 T750S probably benign Het
Prrg4 T G 2: 104,845,054 E68A probably damaging Het
Rcan2 C T 17: 44,017,810 T90M possibly damaging Het
Rlbp1 T C 7: 79,377,345 E189G probably damaging Het
Satb1 A G 17: 51,805,265 F107S probably damaging Het
Sdc3 A T 4: 130,821,202 probably benign Het
Slc22a3 A T 17: 12,507,206 V40D probably damaging Het
Slc35d1 A G 4: 103,190,830 probably null Het
Slfn1 T C 11: 83,121,295 F79S probably damaging Het
Snrpg G T 6: 86,376,575 V46L probably benign Het
Tbl1xr1 G A 3: 22,210,405 C508Y probably benign Het
Thada A T 17: 84,231,136 D1481E probably benign Het
Tnfsf8 A G 4: 63,860,980 V27A probably benign Het
Tns1 T C 1: 73,991,696 H300R probably damaging Het
Ttc13 C A 8: 124,675,253 G589V probably benign Het
Ttc28 A G 5: 110,892,832 I29V possibly damaging Het
Tubb4a T A 17: 57,080,778 N416I possibly damaging Het
Ubr4 T A 4: 139,450,325 I1884N Het
Usp16 A G 16: 87,469,752 K175E probably benign Het
Usp24 A G 4: 106,360,518 I479M probably benign Het
Ythdc2 T C 18: 44,841,375 V368A probably benign Het
Zfp628 T C 7: 4,920,881 S701P probably damaging Het
Other mutations in Utrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Utrn APN 10 12671830 missense probably damaging 1.00
IGL00469:Utrn APN 10 12406529 missense probably damaging 1.00
IGL00518:Utrn APN 10 12666843 splice site probably benign
IGL00560:Utrn APN 10 12455467 nonsense probably null
IGL00589:Utrn APN 10 12678618 missense possibly damaging 0.53
IGL00662:Utrn APN 10 12664961 missense probably damaging 0.99
IGL00754:Utrn APN 10 12663492 missense probably benign 0.05
IGL00772:Utrn APN 10 12649185 missense probably benign
IGL00775:Utrn APN 10 12745230 critical splice donor site probably null
IGL00782:Utrn APN 10 12652811 missense probably benign 0.13
IGL00962:Utrn APN 10 12481334 missense possibly damaging 0.80
IGL01584:Utrn APN 10 12726367 missense probably benign 0.01
IGL01677:Utrn APN 10 12744157 missense probably damaging 1.00
IGL01695:Utrn APN 10 12745342 missense probably benign 0.00
IGL01743:Utrn APN 10 12711557 missense possibly damaging 0.94
IGL01815:Utrn APN 10 12652716 missense probably benign 0.00
IGL01901:Utrn APN 10 12640928 missense probably damaging 1.00
IGL01982:Utrn APN 10 12748029 missense probably damaging 1.00
IGL01983:Utrn APN 10 12669781 missense probably benign 0.18
IGL02031:Utrn APN 10 12735204 missense probably damaging 1.00
IGL02106:Utrn APN 10 12413973 missense possibly damaging 0.92
IGL02134:Utrn APN 10 12643419 missense probably damaging 0.99
IGL02209:Utrn APN 10 12683295 missense probably damaging 0.97
IGL02217:Utrn APN 10 12751559 missense probably damaging 1.00
IGL02250:Utrn APN 10 12436391 missense probably damaging 1.00
IGL02307:Utrn APN 10 12750065 nonsense probably null
IGL02386:Utrn APN 10 12421608 missense possibly damaging 0.91
IGL02494:Utrn APN 10 12710054 missense probably benign
IGL02631:Utrn APN 10 12710063 missense probably benign 0.00
IGL02729:Utrn APN 10 12720810 unclassified probably benign
IGL02736:Utrn APN 10 12421640 missense probably damaging 1.00
IGL02832:Utrn APN 10 12738193 missense possibly damaging 0.82
IGL02926:Utrn APN 10 12690760 missense probably damaging 0.96
IGL03184:Utrn APN 10 12710166 missense probably benign 0.04
IGL03194:Utrn APN 10 12406429 splice site probably benign
IGL03346:Utrn APN 10 12525352 missense probably benign 0.22
retiring UTSW 10 12641020 missense probably damaging 1.00
shrinking_violet UTSW 10 12711585 critical splice acceptor site probably null
Wallflower UTSW 10 12747975 missense probably damaging 1.00
FR4548:Utrn UTSW 10 12633941 critical splice donor site probably benign
I2288:Utrn UTSW 10 12421640 missense probably damaging 1.00
PIT4677001:Utrn UTSW 10 12666704 missense probably benign 0.06
R0022:Utrn UTSW 10 12709956 splice site probably benign
R0024:Utrn UTSW 10 12406011 missense probably benign 0.00
R0024:Utrn UTSW 10 12406011 missense probably benign 0.00
R0026:Utrn UTSW 10 12726196 splice site probably benign
R0026:Utrn UTSW 10 12726196 splice site probably benign
R0091:Utrn UTSW 10 12735204 missense probably damaging 1.00
R0112:Utrn UTSW 10 12686465 nonsense probably null
R0126:Utrn UTSW 10 12711475 missense probably benign 0.02
R0184:Utrn UTSW 10 12667618 missense probably benign
R0219:Utrn UTSW 10 12684451 missense probably damaging 1.00
R0369:Utrn UTSW 10 12634022 missense probably benign 0.37
R0390:Utrn UTSW 10 12710060 missense probably benign 0.05
R0391:Utrn UTSW 10 12525333 splice site probably benign
R0408:Utrn UTSW 10 12384190 makesense probably null
R0409:Utrn UTSW 10 12643601 missense probably benign 0.01
R0441:Utrn UTSW 10 12688294 missense probably null 0.88
R0504:Utrn UTSW 10 12402895 missense probably benign 0.02
R0730:Utrn UTSW 10 12698158 splice site probably benign
R1078:Utrn UTSW 10 12455566 critical splice acceptor site probably null
R1171:Utrn UTSW 10 12481308 missense probably damaging 0.99
R1191:Utrn UTSW 10 12634033 missense probably benign 0.02
R1203:Utrn UTSW 10 12486537 missense probably damaging 1.00
R1401:Utrn UTSW 10 12649153 missense probably benign
R1418:Utrn UTSW 10 12713350 missense probably benign
R1439:Utrn UTSW 10 12744049 missense possibly damaging 0.79
R1441:Utrn UTSW 10 12683295 missense probably damaging 0.97
R1445:Utrn UTSW 10 12678574 splice site probably benign
R1509:Utrn UTSW 10 12455441 missense possibly damaging 0.91
R1546:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1585:Utrn UTSW 10 12436285 missense possibly damaging 0.62
R1621:Utrn UTSW 10 12713283 missense probably benign 0.24
R1637:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1703:Utrn UTSW 10 12727729 splice site probably benign
R1725:Utrn UTSW 10 12663519 missense probably damaging 0.99
R1735:Utrn UTSW 10 12710138 missense probably benign
R1770:Utrn UTSW 10 12475296 missense probably damaging 0.98
R1778:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1783:Utrn UTSW 10 12463339 missense probably damaging 1.00
R1818:Utrn UTSW 10 12709964 critical splice donor site probably null
R1829:Utrn UTSW 10 12475274 missense probably damaging 1.00
R1919:Utrn UTSW 10 12455480 missense probably benign 0.15
R1964:Utrn UTSW 10 12684437 missense probably damaging 1.00
R2080:Utrn UTSW 10 12737082 missense probably benign 0.36
R2092:Utrn UTSW 10 12678698 missense probably benign 0.12
R2107:Utrn UTSW 10 12436364 missense probably damaging 1.00
R2108:Utrn UTSW 10 12436364 missense probably damaging 1.00
R2760:Utrn UTSW 10 12690878 missense probably damaging 1.00
R2884:Utrn UTSW 10 12739361 splice site probably null
R2885:Utrn UTSW 10 12739361 splice site probably null
R2886:Utrn UTSW 10 12739361 splice site probably null
R2903:Utrn UTSW 10 12643428 missense probably damaging 1.00
R2944:Utrn UTSW 10 12643419 missense probably damaging 1.00
R2945:Utrn UTSW 10 12486391 missense possibly damaging 0.50
R3438:Utrn UTSW 10 12481318 missense probably damaging 0.98
R3683:Utrn UTSW 10 12666835 missense probably benign 0.10
R3735:Utrn UTSW 10 12478484 missense probably damaging 1.00
R3907:Utrn UTSW 10 12710182 splice site probably benign
R3923:Utrn UTSW 10 12739479 missense probably benign 0.23
R3925:Utrn UTSW 10 12698042 missense probably benign
R3926:Utrn UTSW 10 12698042 missense probably benign
R3938:Utrn UTSW 10 12750030 critical splice donor site probably null
R3941:Utrn UTSW 10 12711585 critical splice acceptor site probably null
R3958:Utrn UTSW 10 12750108 missense probably damaging 1.00
R4091:Utrn UTSW 10 12710171 missense probably benign 0.10
R4454:Utrn UTSW 10 12727840 missense possibly damaging 0.81
R4585:Utrn UTSW 10 12688306 missense probably benign 0.01
R4667:Utrn UTSW 10 12698053 missense probably benign 0.22
R4684:Utrn UTSW 10 12745240 missense probably damaging 1.00
R4782:Utrn UTSW 10 12750069 missense probably damaging 1.00
R4785:Utrn UTSW 10 12654745 missense probably benign 0.39
R4799:Utrn UTSW 10 12750069 missense probably damaging 1.00
R4829:Utrn UTSW 10 12663461 missense probably benign 0.00
R4878:Utrn UTSW 10 12727758 missense probably damaging 1.00
R4955:Utrn UTSW 10 12861567 critical splice donor site probably null
R4967:Utrn UTSW 10 12455420 missense probably damaging 0.99
R5071:Utrn UTSW 10 12384204 splice site probably null
R5072:Utrn UTSW 10 12384204 splice site probably null
R5186:Utrn UTSW 10 12728777 missense probably damaging 1.00
R5213:Utrn UTSW 10 12636760 missense probably damaging 1.00
R5296:Utrn UTSW 10 12401355 missense probably damaging 1.00
R5309:Utrn UTSW 10 12727769 missense probably damaging 1.00
R5312:Utrn UTSW 10 12727769 missense probably damaging 1.00
R5399:Utrn UTSW 10 12640983 missense probably damaging 1.00
R5407:Utrn UTSW 10 12680625 missense probably damaging 1.00
R5411:Utrn UTSW 10 12649185 missense probably benign
R5428:Utrn UTSW 10 12693431 missense probably benign 0.09
R5595:Utrn UTSW 10 12682318 missense possibly damaging 0.89
R5602:Utrn UTSW 10 12750095 missense probably damaging 1.00
R5608:Utrn UTSW 10 12671837 missense probably benign 0.00
R5678:Utrn UTSW 10 12442018 missense probably damaging 1.00
R5726:Utrn UTSW 10 12669806 missense probably benign
R5804:Utrn UTSW 10 12421625 missense probably damaging 1.00
R5916:Utrn UTSW 10 12665051 missense probably damaging 0.97
R5941:Utrn UTSW 10 12486483 missense probably damaging 1.00
R6014:Utrn UTSW 10 12690876 missense probably benign 0.01
R6015:Utrn UTSW 10 12478424 missense possibly damaging 0.85
R6028:Utrn UTSW 10 12654716 missense probably benign 0.00
R6158:Utrn UTSW 10 12690822 missense probably benign 0.04
R6181:Utrn UTSW 10 12739456 missense probably damaging 1.00
R6300:Utrn UTSW 10 12501476 missense probably benign 0.35
R6367:Utrn UTSW 10 12747975 missense probably damaging 1.00
R6377:Utrn UTSW 10 12744083 missense probably damaging 1.00
R6434:Utrn UTSW 10 12525427 missense probably damaging 1.00
R6498:Utrn UTSW 10 12442093 missense probably benign
R6579:Utrn UTSW 10 12748006 missense probably benign 0.05
R6704:Utrn UTSW 10 12745291 missense probably damaging 0.99
R6736:Utrn UTSW 10 12621303 missense probably benign 0.09
R6755:Utrn UTSW 10 12699087 missense probably benign 0.00
R6793:Utrn UTSW 10 12640925 critical splice donor site probably null
R6793:Utrn UTSW 10 12699100 missense possibly damaging 0.69
R6835:Utrn UTSW 10 12727764 missense probably damaging 1.00
R6919:Utrn UTSW 10 12693470 nonsense probably null
R6920:Utrn UTSW 10 12750470 missense probably damaging 0.98
R7037:Utrn UTSW 10 12826770 splice site probably null
R7038:Utrn UTSW 10 12682338 missense probably damaging 1.00
R7055:Utrn UTSW 10 12747921 missense probably benign 0.23
R7072:Utrn UTSW 10 12465213 missense probably damaging 1.00
R7090:Utrn UTSW 10 12684516 missense possibly damaging 0.58
R7211:Utrn UTSW 10 12401335 missense possibly damaging 0.72
R7248:Utrn UTSW 10 12728818 missense possibly damaging 0.51
R7305:Utrn UTSW 10 12385536 missense probably benign
R7334:Utrn UTSW 10 12728009 splice site probably null
R7348:Utrn UTSW 10 12748018 missense probably damaging 1.00
R7375:Utrn UTSW 10 12641020 missense probably damaging 1.00
R7436:Utrn UTSW 10 12439791 missense possibly damaging 0.72
R7476:Utrn UTSW 10 12640951 missense probably benign
R7514:Utrn UTSW 10 12698089 missense probably benign 0.00
R7527:Utrn UTSW 10 12401382 missense possibly damaging 0.81
R7735:Utrn UTSW 10 12744043 critical splice donor site probably null
R7748:Utrn UTSW 10 12614508 missense probably benign 0.01
R7778:Utrn UTSW 10 12486610 missense probably damaging 1.00
R7824:Utrn UTSW 10 12486610 missense probably damaging 1.00
R7826:Utrn UTSW 10 12401306 splice site probably null
R7872:Utrn UTSW 10 12698129 missense probably benign
R7915:Utrn UTSW 10 12465212 missense probably damaging 1.00
R7922:Utrn UTSW 10 12667527 missense possibly damaging 0.68
R8081:Utrn UTSW 10 12548059 start gained probably benign
R8132:Utrn UTSW 10 12682410 missense probably damaging 0.99
R8167:Utrn UTSW 10 12671814 nonsense probably null
R8186:Utrn UTSW 10 12698123 missense probably benign
R8331:Utrn UTSW 10 12614619 missense probably benign 0.00
R8352:Utrn UTSW 10 12813509 missense probably benign 0.34
R8408:Utrn UTSW 10 12670143 missense possibly damaging 0.69
R8452:Utrn UTSW 10 12813509 missense probably benign 0.34
R8478:Utrn UTSW 10 12649148 missense probably benign
R8489:Utrn UTSW 10 12711446 missense probably benign 0.05
R8516:Utrn UTSW 10 12486510 missense probably damaging 0.99
R8520:Utrn UTSW 10 12670186 nonsense probably null
R8550:Utrn UTSW 10 12813585 intron probably benign
R8856:Utrn UTSW 10 12667607 missense probably benign
R8881:Utrn UTSW 10 12547993 missense possibly damaging 0.46
R9180:Utrn UTSW 10 12669719 missense probably damaging 1.00
R9186:Utrn UTSW 10 12614574 missense probably benign
R9216:Utrn UTSW 10 12813485 missense probably benign 0.19
R9273:Utrn UTSW 10 12633963 missense probably damaging 0.97
R9307:Utrn UTSW 10 12678731 missense probably benign 0.02
R9344:Utrn UTSW 10 12684531 missense probably benign 0.17
R9419:Utrn UTSW 10 12688381 missense probably damaging 1.00
R9435:Utrn UTSW 10 12643429 missense probably damaging 1.00
R9623:Utrn UTSW 10 12406481 missense probably damaging 1.00
R9650:Utrn UTSW 10 12738185 missense probably benign 0.00
R9653:Utrn UTSW 10 12621379 missense probably benign 0.17
R9653:Utrn UTSW 10 12663445 missense probably benign 0.41
R9672:Utrn UTSW 10 12727869 missense possibly damaging 0.68
R9678:Utrn UTSW 10 12739415 missense probably benign 0.00
R9741:Utrn UTSW 10 12826820 missense probably benign
R9765:Utrn UTSW 10 12735177 missense probably damaging 0.99
R9799:Utrn UTSW 10 12709992 missense probably benign 0.01
RF009:Utrn UTSW 10 12633945 nonsense probably null
V1662:Utrn UTSW 10 12421640 missense probably damaging 1.00
X0018:Utrn UTSW 10 12735198 missense probably damaging 1.00
Z1176:Utrn UTSW 10 12682360 nonsense probably null
Z1176:Utrn UTSW 10 12688429 critical splice acceptor site probably null
Z1177:Utrn UTSW 10 12525406 nonsense probably null
Z1177:Utrn UTSW 10 12621379 missense probably benign 0.17
Z1186:Utrn UTSW 10 12669747 missense probably damaging 1.00
Z1189:Utrn UTSW 10 12669747 missense probably damaging 1.00
Z1191:Utrn UTSW 10 12669747 missense probably damaging 1.00
Z1192:Utrn UTSW 10 12669747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACTTGTTTGCTAAGTGGGTCCC -3'
(R):5'- TTGCGAGCCATCTCTCCAAC -3'

Sequencing Primer
(F):5'- TAAGTGGGTCCCGGCGG -3'
(R):5'- TCCAACCCCTGTACATATTATATAGC -3'
Posted On 2022-03-25