Incidental Mutation 'R9252:Acap2'
ID 701625
Institutional Source Beutler Lab
Gene Symbol Acap2
Ensembl Gene ENSMUSG00000049076
Gene Name ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Synonyms Centb2, 9530039J15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock # R9252 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 31092412-31201245 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 31101823 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000061501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058033] [ENSMUST00000229010] [ENSMUST00000230614] [ENSMUST00000230698] [ENSMUST00000231125]
AlphaFold Q6ZQK5
Predicted Effect probably null
Transcript: ENSMUST00000058033
SMART Domains Protein: ENSMUSP00000061501
Gene: ENSMUSG00000049076

DomainStartEndE-ValueType
Pfam:BAR_3 5 238 9.1e-96 PFAM
PH 267 363 1.73e-17 SMART
ArfGap 399 520 2.23e-63 SMART
ANK 632 661 6.71e-2 SMART
ANK 665 694 3.04e0 SMART
ANK 698 727 6.64e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229010
Predicted Effect probably benign
Transcript: ENSMUST00000230614
Predicted Effect probably benign
Transcript: ENSMUST00000230698
Predicted Effect probably benign
Transcript: ENSMUST00000231125
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik A G 8: 84,172,249 S589G possibly damaging Het
Adgrb3 T C 1: 25,826,415 N116D probably benign Het
Arfgef1 T A 1: 10,172,897 R1073* probably null Het
Atp6v1d T A 12: 78,857,249 Q46L probably benign Het
C77080 A G 4: 129,223,476 V510A probably benign Het
Car15 A T 16: 17,835,382 L307* probably null Het
Catspere2 A T 1: 178,111,430 H623L possibly damaging Het
Ccdc146 T C 5: 21,297,025 D797G probably damaging Het
Ccdc27 A T 4: 154,041,050 D112E unknown Het
Ccp110 A G 7: 118,722,450 I443V probably benign Het
Cd74 T A 18: 60,808,292 M103K possibly damaging Het
Cdca2 T A 14: 67,677,382 R809S possibly damaging Het
Cfap46 A T 7: 139,618,249 V2061E unknown Het
Ddx11 G A 17: 66,150,812 E873K probably benign Het
Gucy2d G A 7: 98,467,772 probably null Het
Herc1 T A 9: 66,402,552 S1061R probably damaging Het
Ildr1 G A 16: 36,716,212 R201H probably damaging Het
Jakmip2 T A 18: 43,582,129 I111F possibly damaging Het
Kcnj2 A G 11: 111,072,529 D249G probably damaging Het
Kif1a T A 1: 93,075,054 T208S probably damaging Het
Mgam T G 6: 40,729,643 M76R probably damaging Het
Mib1 T G 18: 10,800,088 I809S probably benign Het
Myh8 G T 11: 67,286,476 R456L probably damaging Het
Mzf1 T C 7: 13,043,720 T665A probably benign Het
Nfya T C 17: 48,392,915 H27R Het
Nktr T C 9: 121,750,349 M1161T unknown Het
Nox4 G A 7: 87,376,240 R525Q probably benign Het
Odf3b T C 15: 89,378,398 S119G probably benign Het
Olfr156 C T 4: 43,821,109 G84D probably benign Het
Pde8b C T 13: 95,032,916 D567N probably damaging Het
Pik3cd A G 4: 149,655,630 I491T possibly damaging Het
Plcd3 G T 11: 103,077,554 Y392* probably null Het
Plcd4 A G 1: 74,549,200 I69M probably damaging Het
Plekhm2 T C 4: 141,629,132 Y799C probably damaging Het
Pnlip T A 19: 58,680,841 I424N possibly damaging Het
Ptprq A G 10: 107,686,386 V568A probably benign Het
Rtkn A G 6: 83,148,162 E201G probably damaging Het
Scg2 C T 1: 79,436,352 R218H probably damaging Het
Shank2 A G 7: 144,068,798 H223R possibly damaging Het
Slc23a2 A T 2: 132,071,922 F312I probably damaging Het
Slc24a1 T A 9: 64,928,112 E911V probably damaging Het
St8sia4 CCTCT CCT 1: 95,627,507 probably null Het
Stat1 C A 1: 52,135,672 Q178K probably benign Het
Stat6 A C 10: 127,647,792 N75T probably benign Het
Stk10 G T 11: 32,588,915 K251N Het
Sult1e1 G T 5: 87,590,114 A36E probably damaging Het
Tbc1d12 A G 19: 38,911,033 S466G probably benign Het
Thsd4 C A 9: 60,056,947 A421S probably benign Het
Tsga10 T A 1: 37,834,283 I172L probably benign Het
Ttn A T 2: 76,770,512 M18842K probably benign Het
Twf2 A G 9: 106,211,800 D62G probably benign Het
Ube2cbp C A 9: 86,372,448 V327F probably damaging Het
Ugt1a8 T C 1: 88,087,984 S40P probably benign Het
Unc13c A T 9: 73,517,271 I2021N possibly damaging Het
Vmn2r97 A T 17: 18,947,587 Y701F probably benign Het
Other mutations in Acap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Acap2 APN 16 31139475 missense probably damaging 1.00
IGL01330:Acap2 APN 16 31154677 missense probably damaging 1.00
IGL01420:Acap2 APN 16 31101819 splice site probably benign
IGL02064:Acap2 APN 16 31127328 missense probably damaging 1.00
IGL02173:Acap2 APN 16 31108147 missense possibly damaging 0.68
IGL02453:Acap2 APN 16 31131257 splice site probably null
IGL02883:Acap2 APN 16 31096345 unclassified probably benign
IGL03203:Acap2 APN 16 31096345 unclassified probably benign
IGL03342:Acap2 APN 16 31105492 missense probably damaging 1.00
R1251:Acap2 UTSW 16 31108171 missense probably damaging 1.00
R1377:Acap2 UTSW 16 31116051 missense probably damaging 1.00
R1432:Acap2 UTSW 16 31111083 missense probably damaging 1.00
R1546:Acap2 UTSW 16 31104936 nonsense probably null
R1594:Acap2 UTSW 16 31127387 missense probably benign 0.01
R1829:Acap2 UTSW 16 31110934 missense probably damaging 1.00
R1853:Acap2 UTSW 16 31117304 missense probably damaging 1.00
R1970:Acap2 UTSW 16 31133527 critical splice donor site probably null
R2023:Acap2 UTSW 16 31119415 missense probably damaging 0.99
R2086:Acap2 UTSW 16 31110945 missense probably damaging 1.00
R2145:Acap2 UTSW 16 31105524 missense probably benign
R2177:Acap2 UTSW 16 31133528 critical splice donor site probably null
R2214:Acap2 UTSW 16 31108128 missense probably benign 0.19
R2392:Acap2 UTSW 16 31139640 missense probably damaging 0.99
R2438:Acap2 UTSW 16 31117315 missense probably damaging 1.00
R2913:Acap2 UTSW 16 31116069 missense probably damaging 0.99
R4207:Acap2 UTSW 16 31119427 missense probably damaging 0.99
R4274:Acap2 UTSW 16 31108114 missense probably benign 0.01
R4814:Acap2 UTSW 16 31108126 missense probably benign
R4860:Acap2 UTSW 16 31103499 missense possibly damaging 0.92
R4860:Acap2 UTSW 16 31103499 missense possibly damaging 0.92
R5310:Acap2 UTSW 16 31133609 missense probably benign 0.00
R5345:Acap2 UTSW 16 31108126 missense probably benign
R5388:Acap2 UTSW 16 31109725 missense probably damaging 1.00
R5551:Acap2 UTSW 16 31104908 missense probably damaging 1.00
R5578:Acap2 UTSW 16 31108114 missense probably benign 0.00
R6341:Acap2 UTSW 16 31105546 missense possibly damaging 0.86
R6659:Acap2 UTSW 16 31131315 missense probably damaging 0.99
R6977:Acap2 UTSW 16 31117261 missense probably damaging 1.00
R7262:Acap2 UTSW 16 31127319 critical splice donor site probably null
R7304:Acap2 UTSW 16 31108116 missense probably benign 0.05
R7310:Acap2 UTSW 16 31108154 nonsense probably null
R7318:Acap2 UTSW 16 31127337 missense probably damaging 1.00
R7514:Acap2 UTSW 16 31154567 splice site probably null
R7875:Acap2 UTSW 16 31139641 missense probably damaging 0.99
R8256:Acap2 UTSW 16 31139469 critical splice donor site probably null
R9026:Acap2 UTSW 16 31107088 missense probably damaging 0.99
R9177:Acap2 UTSW 16 31136574 missense probably damaging 1.00
R9268:Acap2 UTSW 16 31136574 missense probably damaging 1.00
R9329:Acap2 UTSW 16 31127420 missense probably damaging 1.00
R9467:Acap2 UTSW 16 31111083 missense possibly damaging 0.54
R9528:Acap2 UTSW 16 31111090 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- AGTTTGTGGAAAGGCCCAGG -3'
(R):5'- CACGTTTTACACTGACAGATGCC -3'

Sequencing Primer
(F):5'- TTAGCCACCTGGGAATTCAG -3'
(R):5'- TTTACACTGACAGATGCCGGTAAAG -3'
Posted On 2022-03-25