Mutagenetix > Incidental Mutation

Incidental Mutation 'R9253:Cntnap2'

701654

Institutional Source

Beutler Lab

Gene Symbol

Cntnap2

Ensembl Gene

ENSMUSG00000039419

Gene Name

contactin associated protein-like 2

Synonyms

5430425M22Rik, Caspr2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9253 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

45059357-47304213 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 46001178 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 256 (L256F)

Ref Sequence

ENSEMBL: ENSMUSP00000110288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114641]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000114641
AA Change: L256F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: L256F

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	34	181	3.99e-22	SMART
LamG	208	345	5.5e-34	SMART
LamG	393	529	3.31e-28	SMART
EGF	557	591	5.04e-2	SMART
Blast:FBG	594	777	7e-68	BLAST
LamG	819	945	5.58e-35	SMART
EGF	966	1002	2.11e1	SMART
LamG	1048	1188	3.55e-28	SMART
low complexity region	1263	1273	N/A	INTRINSIC
4.1m	1283	1301	4.21e-7	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts19	A	G	18: 58,969,941	N685D	probably damaging	Het
Adh4	A	T	3: 138,424,099	I229F	probably damaging	Het
Aldh3b1	T	A	19: 3,915,315	S399C	probably damaging	Het
Arhgef28	C	T	13: 97,988,271	G501D	probably benign	Het
Asb1	C	A	1: 91,540,829	T6N	unknown	Het
Asb18	C	T	1: 89,954,463	V382I	probably benign	Het
AU041133	T	C	10: 82,151,386	I291T	probably benign	Het
B4galnt2	C	T	11: 95,868,350		silent	Het
Bcl7c	T	C	7: 127,707,231		probably benign	Het
Brinp1	T	C	4: 68,792,846	N375S	possibly damaging	Het
C6	A	G	15: 4,735,197	Q125R	probably benign	Het
Card14	T	C	11: 119,321,933	S108P	probably benign	Het
Clec4a2	C	A	6: 123,123,649	T21N	probably damaging	Het
Cobll1	G	A	2: 65,151,159	T29I	probably benign	Het
Coq4	A	T	2: 29,795,421	D149V	probably damaging	Het
Dync1i1	T	C	6: 5,769,698	L91S	probably benign	Het
Fat2	T	A	11: 55,310,571	D559V	probably damaging	Het
Gm4779	TGGCAGAGGCAGAGGCAGAGGCAGAGGCAGAGGCAG	TGGCAGAGGCAGAGGCAGAGGCAGAGGCAGAGGCAGAGGCAG	X: 101,793,311		probably benign	Het
Gm996	T	C	2: 25,577,160	H913R	possibly damaging	Het
Gsdmc	A	T	15: 63,804,558	V12E	probably damaging	Het
H2-Ab1	T	C	17: 34,267,404	S146P	probably damaging	Het
Heatr5b	A	G	17: 78,827,994	V236A	probably benign	Het
Hfe2	T	C	3: 96,528,394	S323P	probably benign	Het
Hmgcr	C	T	13: 96,660,137	C215Y	probably damaging	Het
L3mbtl1	G	T	2: 162,947,712	A57S	probably benign	Het
Lilr4b	G	A	10: 51,481,767	V186I	probably damaging	Het
Map1a	T	C	2: 121,302,342	V1213A	probably benign	Het
Marf1	T	C	16: 14,117,308	E1532G	probably damaging	Het
Mcm6	T	C	1: 128,351,527	Y174C	probably damaging	Het
Miga2	T	A	2: 30,371,227	V178E	probably benign	Het
Myh11	T	A	16: 14,256,495	I174F		Het
Ndufv1	G	T	19: 4,009,412	A211E	probably damaging	Het
Nicn1	C	T	9: 108,294,509	R163C	possibly damaging	Het
Nlgn3	T	C	X: 101,308,784	V179A	probably damaging	Het
Nrp1	T	C	8: 128,502,663	V874A	possibly damaging	Het
Nsf	C	T	11: 103,913,316	G197S	probably null	Het
Olfr118	A	T	17: 37,672,746	H241L	probably benign	Het
Olfr1395	T	C	11: 49,148,995	M246T	probably damaging	Het
Pacs2	A	G	12: 113,050,517	D196G	probably benign	Het
Pbxip1	A	G	3: 89,443,705	D118G	probably benign	Het
Pcdhb11	A	T	18: 37,421,476		probably benign	Het
Pgk2	C	T	17: 40,208,342	G65D	probably damaging	Het
Plcd3	T	C	11: 103,079,634	D193G	probably benign	Het
Plcl2	T	G	17: 50,608,099	M712R	probably damaging	Het
Plxna1	G	A	6: 89,357,540	Q36*	probably null	Het
Plxnb2	A	G	15: 89,167,812	V68A	probably benign	Het
Polr2b	A	G	5: 77,345,377	I1069V	probably benign	Het
Rbfox1	A	G	16: 7,294,109	T200A	probably benign	Het
Rspry1	T	A	8: 94,622,993	V3D	probably damaging	Het
Serpinb6d	T	C	13: 33,671,222	M293T	probably damaging	Het
Slc4a8	A	G	15: 100,783,032	R72G	probably benign	Het
Smarca5	A	C	8: 80,719,715	L452W	probably damaging	Het
Srcin1	T	C	11: 97,525,551	K952E	probably damaging	Het
Synpo2l	G	T	14: 20,666,670	Q79K	possibly damaging	Het
Tmem174	T	C	13: 98,637,295	E9G	possibly damaging	Het
Tmem270	T	C	5: 134,901,790	T206A	probably damaging	Het
Ttn	T	A	2: 76,732,607	T28668S	possibly damaging	Het
Vmn1r118	A	T	7: 20,911,892	S152R	possibly damaging	Het
Vmn2r25	T	A	6: 123,840,001	Q207L	probably damaging	Het
Vmn2r81	T	A	10: 79,293,748	S824R	probably damaging	Het
Vps54	G	A	11: 21,308,771	V733I	probably benign	Het
Zfp518b	G	T	5: 38,672,258	D801E	probably benign	Het
Zgrf1	C	A	3: 127,598,779	P1316Q	probably damaging	Het
Zzef1	C	A	11: 72,848,637		probably benign	Het

Other mutations in Cntnap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cntnap2	APN	6	46015263	missense	possibly damaging	0.92
IGL00657:Cntnap2	APN	6	46988787	missense	probably damaging	0.98
IGL00846:Cntnap2	APN	6	47193038	missense	probably benign	0.12
IGL00851:Cntnap2	APN	6	46484072	missense	probably benign
IGL00857:Cntnap2	APN	6	47049424	missense	probably benign	0.00
IGL01290:Cntnap2	APN	6	46015465	missense	probably benign	0.06
IGL01445:Cntnap2	APN	6	47193013	missense	probably benign	0.14
IGL01468:Cntnap2	APN	6	47271371	nonsense	probably null
IGL01859:Cntnap2	APN	6	46988721	missense	probably damaging	1.00
IGL02092:Cntnap2	APN	6	46234203	missense	probably damaging	1.00
IGL02239:Cntnap2	APN	6	47021654	missense	probably damaging	0.99
IGL02508:Cntnap2	APN	6	46234320	missense	probably damaging	1.00
IGL02530:Cntnap2	APN	6	47021736	missense	possibly damaging	0.48
IGL03013:Cntnap2	APN	6	47095549	missense	possibly damaging	0.66
BB004:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
BB014:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
IGL02802:Cntnap2	UTSW	6	46170245	missense	probably damaging	1.00
R0001:Cntnap2	UTSW	6	46530171	missense	probably benign	0.04
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0043:Cntnap2	UTSW	6	46483983	missense	probably benign	0.01
R0118:Cntnap2	UTSW	6	45060392	splice site	probably null
R0352:Cntnap2	UTSW	6	45992084	splice site	probably null
R0389:Cntnap2	UTSW	6	46009637	missense	probably benign	0.06
R0482:Cntnap2	UTSW	6	45715816	missense	probably benign	0.00
R0530:Cntnap2	UTSW	6	46529905	nonsense	probably null
R0611:Cntnap2	UTSW	6	47095549	missense	possibly damaging	0.66
R0630:Cntnap2	UTSW	6	46988760	missense	probably damaging	0.99
R0636:Cntnap2	UTSW	6	47296708	splice site	probably benign
R0976:Cntnap2	UTSW	6	47271230	missense	probably damaging	1.00
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1387:Cntnap2	UTSW	6	47107914	missense	probably benign	0.19
R1524:Cntnap2	UTSW	6	46530679	missense	probably damaging	1.00
R1609:Cntnap2	UTSW	6	46015330	missense	probably benign	0.13
R1716:Cntnap2	UTSW	6	47107892	nonsense	probably null
R1757:Cntnap2	UTSW	6	46759829	missense	probably damaging	1.00
R1809:Cntnap2	UTSW	6	46988675	missense	probably damaging	0.99
R1813:Cntnap2	UTSW	6	46530633	missense	probably damaging	1.00
R2103:Cntnap2	UTSW	6	47298588	missense	probably damaging	1.00
R2133:Cntnap2	UTSW	6	47298445	missense	probably damaging	1.00
R3037:Cntnap2	UTSW	6	46015266	missense	possibly damaging	0.57
R3899:Cntnap2	UTSW	6	45991903	missense	probably benign	0.00
R4027:Cntnap2	UTSW	6	46856128	missense	probably benign
R4030:Cntnap2	UTSW	6	46856128	missense	probably benign
R4237:Cntnap2	UTSW	6	46530390	intron	probably benign
R4445:Cntnap2	UTSW	6	46759851	missense	probably benign	0.01
R4737:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4740:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4915:Cntnap2	UTSW	6	46530035	intron	probably benign
R4918:Cntnap2	UTSW	6	46530035	intron	probably benign
R4999:Cntnap2	UTSW	6	45920834	missense	probably damaging	0.96
R5373:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5374:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5742:Cntnap2	UTSW	6	45920926	nonsense	probably null
R5748:Cntnap2	UTSW	6	45715884	missense	probably damaging	1.00
R5765:Cntnap2	UTSW	6	46529815	intron	probably benign
R6118:Cntnap2	UTSW	6	47193077	missense	possibly damaging	0.81
R6181:Cntnap2	UTSW	6	46759808	missense	probably damaging	1.00
R6189:Cntnap2	UTSW	6	47271298	missense	probably damaging	1.00
R6262:Cntnap2	UTSW	6	45060112	splice site	probably null
R6385:Cntnap2	UTSW	6	46856180	missense	probably benign	0.00
R6555:Cntnap2	UTSW	6	46759760	missense	probably damaging	1.00
R6577:Cntnap2	UTSW	6	46170272	missense	probably benign	0.25
R6610:Cntnap2	UTSW	6	46015257	missense	probably benign	0.08
R6761:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R7125:Cntnap2	UTSW	6	46988646	missense	probably benign	0.12
R7329:Cntnap2	UTSW	6	47271271	missense	possibly damaging	0.94
R7502:Cntnap2	UTSW	6	46484029	missense	possibly damaging	0.83
R7927:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
R8057:Cntnap2	UTSW	6	46347145	missense	probably damaging	0.98
R8261:Cntnap2	UTSW	6	47095693	missense	probably damaging	0.98
R8356:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R8479:Cntnap2	UTSW	6	46759773	missense	probably benign	0.14
R8503:Cntnap2	UTSW	6	45992041	missense	probably damaging	1.00
R8698:Cntnap2	UTSW	6	47049222	missense	probably damaging	1.00
R8719:Cntnap2	UTSW	6	46001227	missense	probably damaging	1.00
R8816:Cntnap2	UTSW	6	46856142	missense	possibly damaging	0.72
R8987:Cntnap2	UTSW	6	46484049	missense	probably benign	0.01
R9000:Cntnap2	UTSW	6	46484205	intron	probably benign
R9209:Cntnap2	UTSW	6	47049249	missense	probably damaging	1.00
R9310:Cntnap2	UTSW	6	46001347	missense	probably damaging	1.00
R9395:Cntnap2	UTSW	6	46001310	missense	probably damaging	0.98
R9462:Cntnap2	UTSW	6	46234283	missense	probably damaging	0.99
R9526:Cntnap2	UTSW	6	46015231	missense	probably damaging	1.00
R9600:Cntnap2	UTSW	6	45992075	missense	probably damaging	0.98
R9621:Cntnap2	UTSW	6	46988792	missense	probably damaging	0.98
R9738:Cntnap2	UTSW	6	46015439	frame shift	probably null
R9745:Cntnap2	UTSW	6	46234166	missense	probably benign	0.01
R9775:Cntnap2	UTSW	6	47049327	missense	probably damaging	1.00
RF022:Cntnap2	UTSW	6	47021665	missense	probably damaging	1.00
X0018:Cntnap2	UTSW	6	46009518	missense	possibly damaging	0.53
X0063:Cntnap2	UTSW	6	47021754	missense	possibly damaging	0.92
X0066:Cntnap2	UTSW	6	46234245	missense	probably benign	0.03
Z1176:Cntnap2	UTSW	6	47271148	missense	probably benign	0.00
Z1177:Cntnap2	UTSW	6	46015299	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- AGGCTTCTCCTCACTGTTAACAG -3'
(R):5'- AGTAGAGTATGAATTCTGTCCTCC -3'

Sequencing Primer
(F):5'- CCTGGCCTACACTAACTT -3'
(R):5'- TATAATCCTACCTCATAGTCCAAGTC -3'

Posted On

2022-03-25