Incidental Mutation 'R9253:Smarca5'
ID 701659
Institutional Source Beutler Lab
Gene Symbol Smarca5
Ensembl Gene ENSMUSG00000031715
Gene Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5
Synonyms D030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9253 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 80698507-80739497 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 80719715 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Tryptophan at position 452 (L452W)
Ref Sequence ENSEMBL: ENSMUSP00000044361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043359]
AlphaFold Q91ZW3
Predicted Effect probably damaging
Transcript: ENSMUST00000043359
AA Change: L452W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: L452W

DomainStartEndE-ValueType
low complexity region 2 53 N/A INTRINSIC
Pfam:DBINO 65 112 1.1e-4 PFAM
low complexity region 145 156 N/A INTRINSIC
DEXDc 175 367 3.9e-46 SMART
Blast:DEXDc 386 421 6e-11 BLAST
HELICc 512 596 6.2e-28 SMART
low complexity region 756 768 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
SANT 840 889 2.3e-7 SMART
SANT 942 1006 3e-7 SMART
low complexity region 1008 1024 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A G 18: 58,969,941 N685D probably damaging Het
Adh4 A T 3: 138,424,099 I229F probably damaging Het
Aldh3b1 T A 19: 3,915,315 S399C probably damaging Het
Arhgef28 C T 13: 97,988,271 G501D probably benign Het
Asb1 C A 1: 91,540,829 T6N unknown Het
Asb18 C T 1: 89,954,463 V382I probably benign Het
AU041133 T C 10: 82,151,386 I291T probably benign Het
Brinp1 T C 4: 68,792,846 N375S possibly damaging Het
C6 A G 15: 4,735,197 Q125R probably benign Het
Card14 T C 11: 119,321,933 S108P probably benign Het
Clec4a2 C A 6: 123,123,649 T21N probably damaging Het
Cntnap2 C T 6: 46,001,178 L256F probably benign Het
Cobll1 G A 2: 65,151,159 T29I probably benign Het
Coq4 A T 2: 29,795,421 D149V probably damaging Het
Dync1i1 T C 6: 5,769,698 L91S probably benign Het
Fat2 T A 11: 55,310,571 D559V probably damaging Het
Gm4779 TGGCAGAGGCAGAGGCAGAGGCAGAGGCAGAGGCAG TGGCAGAGGCAGAGGCAGAGGCAGAGGCAGAGGCAGAGGCAG X: 101,793,311 probably benign Het
Gm996 T C 2: 25,577,160 H913R possibly damaging Het
Gsdmc A T 15: 63,804,558 V12E probably damaging Het
H2-Ab1 T C 17: 34,267,404 S146P probably damaging Het
Heatr5b A G 17: 78,827,994 V236A probably benign Het
Hfe2 T C 3: 96,528,394 S323P probably benign Het
Hmgcr C T 13: 96,660,137 C215Y probably damaging Het
L3mbtl1 G T 2: 162,947,712 A57S probably benign Het
Lilr4b G A 10: 51,481,767 V186I probably damaging Het
Map1a T C 2: 121,302,342 V1213A probably benign Het
Marf1 T C 16: 14,117,308 E1532G probably damaging Het
Mcm6 T C 1: 128,351,527 Y174C probably damaging Het
Miga2 T A 2: 30,371,227 V178E probably benign Het
Myh11 T A 16: 14,256,495 I174F Het
Ndufv1 G T 19: 4,009,412 A211E probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Nrp1 T C 8: 128,502,663 V874A possibly damaging Het
Nsf C T 11: 103,913,316 G197S probably null Het
Olfr118 A T 17: 37,672,746 H241L probably benign Het
Olfr1395 T C 11: 49,148,995 M246T probably damaging Het
Pacs2 A G 12: 113,050,517 D196G probably benign Het
Pbxip1 A G 3: 89,443,705 D118G probably benign Het
Pcdhb11 A T 18: 37,421,476 probably benign Het
Pgk2 C T 17: 40,208,342 G65D probably damaging Het
Plcd3 T C 11: 103,079,634 D193G probably benign Het
Plcl2 T G 17: 50,608,099 M712R probably damaging Het
Plxna1 G A 6: 89,357,540 Q36* probably null Het
Plxnb2 A G 15: 89,167,812 V68A probably benign Het
Polr2b A G 5: 77,345,377 I1069V probably benign Het
Rbfox1 A G 16: 7,294,109 T200A probably benign Het
Rspry1 T A 8: 94,622,993 V3D probably damaging Het
Serpinb6d T C 13: 33,671,222 M293T probably damaging Het
Slc4a8 A G 15: 100,783,032 R72G probably benign Het
Srcin1 T C 11: 97,525,551 K952E probably damaging Het
Synpo2l G T 14: 20,666,670 Q79K possibly damaging Het
Tmem174 T C 13: 98,637,295 E9G possibly damaging Het
Tmem270 T C 5: 134,901,790 T206A probably damaging Het
Ttn T A 2: 76,732,607 T28668S possibly damaging Het
Vmn1r118 A T 7: 20,911,892 S152R possibly damaging Het
Vmn2r25 T A 6: 123,840,001 Q207L probably damaging Het
Vmn2r81 T A 10: 79,293,748 S824R probably damaging Het
Vps54 G A 11: 21,308,771 V733I probably benign Het
Zfp518b G T 5: 38,672,258 D801E probably benign Het
Zgrf1 C A 3: 127,598,779 P1316Q probably damaging Het
Other mutations in Smarca5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Smarca5 APN 8 80714041 missense probably benign 0.10
IGL01138:Smarca5 APN 8 80701076 missense possibly damaging 0.87
IGL01290:Smarca5 APN 8 80727648 missense probably benign
IGL02338:Smarca5 APN 8 80719570 splice site probably benign
IGL03212:Smarca5 APN 8 80711781 missense possibly damaging 0.47
IGL03216:Smarca5 APN 8 80719658 missense probably damaging 1.00
Cipher UTSW 8 80719652 missense probably damaging 1.00
Codebook UTSW 8 80733707 missense probably benign
Codex UTSW 8 80710563 missense probably damaging 0.99
Encryption UTSW 8 80704726 missense probably damaging 1.00
Enigma UTSW 8 80705332 missense probably benign 0.35
Key UTSW 8 80726051 missense probably damaging 1.00
tinker UTSW 8 80733750 missense probably benign
R0254:Smarca5 UTSW 8 80704700 missense probably benign 0.05
R0374:Smarca5 UTSW 8 80736731 missense probably benign 0.30
R0625:Smarca5 UTSW 8 80720686 critical splice donor site probably null
R1065:Smarca5 UTSW 8 80704714 missense probably damaging 1.00
R1164:Smarca5 UTSW 8 80710631 missense probably damaging 1.00
R1709:Smarca5 UTSW 8 80709220 nonsense probably null
R2102:Smarca5 UTSW 8 80704675 missense probably damaging 1.00
R3831:Smarca5 UTSW 8 80728494 missense probably damaging 0.99
R4625:Smarca5 UTSW 8 80710563 missense probably damaging 0.99
R4750:Smarca5 UTSW 8 80733707 missense probably benign
R4822:Smarca5 UTSW 8 80708680 splice site probably null
R4889:Smarca5 UTSW 8 80704697 missense possibly damaging 0.95
R5756:Smarca5 UTSW 8 80710604 missense probably benign
R6120:Smarca5 UTSW 8 80711743 missense probably damaging 0.98
R6582:Smarca5 UTSW 8 80719652 missense probably damaging 1.00
R6939:Smarca5 UTSW 8 80705320 missense possibly damaging 0.63
R6972:Smarca5 UTSW 8 80704751 missense probably damaging 1.00
R6973:Smarca5 UTSW 8 80704751 missense probably damaging 1.00
R7027:Smarca5 UTSW 8 80736726 missense probably benign 0.07
R7376:Smarca5 UTSW 8 80726051 missense probably damaging 1.00
R7514:Smarca5 UTSW 8 80717534 missense probably damaging 1.00
R7962:Smarca5 UTSW 8 80736759 missense probably benign
R8031:Smarca5 UTSW 8 80704682 missense probably damaging 1.00
R8400:Smarca5 UTSW 8 80709127 missense probably benign 0.02
R8798:Smarca5 UTSW 8 80716508 missense probably damaging 1.00
R8817:Smarca5 UTSW 8 80733750 missense probably benign
R8824:Smarca5 UTSW 8 80705332 missense probably benign 0.35
R8905:Smarca5 UTSW 8 80713948 missense probably benign 0.14
R9018:Smarca5 UTSW 8 80704726 missense probably damaging 1.00
R9028:Smarca5 UTSW 8 80714013 missense probably damaging 1.00
R9203:Smarca5 UTSW 8 80704629 nonsense probably null
R9294:Smarca5 UTSW 8 80719803 missense probably damaging 1.00
R9328:Smarca5 UTSW 8 80720749 missense probably benign 0.00
R9396:Smarca5 UTSW 8 80736729 missense probably benign 0.00
R9514:Smarca5 UTSW 8 80702211 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGTCGCTACTCTGCATG -3'
(R):5'- TGGAAGCAAATTTCAGGCAGTG -3'

Sequencing Primer
(F):5'- ATGGTCGCTACTCTGCATGTTTATC -3'
(R):5'- AGCAAATTTCAGGCAGTGGTTTTTC -3'
Posted On 2022-03-25