Incidental Mutation 'R9253:Rspry1'
ID 701660
Institutional Source Beutler Lab
Gene Symbol Rspry1
Ensembl Gene ENSMUSG00000050079
Gene Name ring finger and SPRY domain containing 1
Synonyms 4930470D19Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock # R9253 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 94601937-94660275 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 94622993 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 3 (V3D)
Ref Sequence ENSEMBL: ENSMUSP00000057275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060389] [ENSMUST00000121101] [ENSMUST00000211983] [ENSMUST00000212729]
AlphaFold Q8BVR6
Predicted Effect probably damaging
Transcript: ENSMUST00000060389
AA Change: V3D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057275
Gene: ENSMUSG00000050079
AA Change: V3D

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 30 39 N/A INTRINSIC
low complexity region 74 95 N/A INTRINSIC
SPRY 358 482 2.94e-26 SMART
RING 527 561 3.93e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121101
AA Change: V3D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112482
Gene: ENSMUSG00000050079
AA Change: V3D

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 30 39 N/A INTRINSIC
low complexity region 74 95 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211983
AA Change: V3D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000212729
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that contains a RING-type zinc finger domain and an SPRY domain of unknown function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A G 18: 58,969,941 N685D probably damaging Het
Adh4 A T 3: 138,424,099 I229F probably damaging Het
Aldh3b1 T A 19: 3,915,315 S399C probably damaging Het
Arhgef28 C T 13: 97,988,271 G501D probably benign Het
Asb1 C A 1: 91,540,829 T6N unknown Het
Asb18 C T 1: 89,954,463 V382I probably benign Het
AU041133 T C 10: 82,151,386 I291T probably benign Het
Brinp1 T C 4: 68,792,846 N375S possibly damaging Het
C6 A G 15: 4,735,197 Q125R probably benign Het
Card14 T C 11: 119,321,933 S108P probably benign Het
Clec4a2 C A 6: 123,123,649 T21N probably damaging Het
Cntnap2 C T 6: 46,001,178 L256F probably benign Het
Cobll1 G A 2: 65,151,159 T29I probably benign Het
Coq4 A T 2: 29,795,421 D149V probably damaging Het
Dync1i1 T C 6: 5,769,698 L91S probably benign Het
Fat2 T A 11: 55,310,571 D559V probably damaging Het
Gm4779 TGGCAGAGGCAGAGGCAGAGGCAGAGGCAGAGGCAG TGGCAGAGGCAGAGGCAGAGGCAGAGGCAGAGGCAGAGGCAG X: 101,793,311 probably benign Het
Gm996 T C 2: 25,577,160 H913R possibly damaging Het
Gsdmc A T 15: 63,804,558 V12E probably damaging Het
H2-Ab1 T C 17: 34,267,404 S146P probably damaging Het
Heatr5b A G 17: 78,827,994 V236A probably benign Het
Hfe2 T C 3: 96,528,394 S323P probably benign Het
Hmgcr C T 13: 96,660,137 C215Y probably damaging Het
L3mbtl1 G T 2: 162,947,712 A57S probably benign Het
Lilr4b G A 10: 51,481,767 V186I probably damaging Het
Map1a T C 2: 121,302,342 V1213A probably benign Het
Marf1 T C 16: 14,117,308 E1532G probably damaging Het
Mcm6 T C 1: 128,351,527 Y174C probably damaging Het
Miga2 T A 2: 30,371,227 V178E probably benign Het
Myh11 T A 16: 14,256,495 I174F Het
Ndufv1 G T 19: 4,009,412 A211E probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Nrp1 T C 8: 128,502,663 V874A possibly damaging Het
Nsf C T 11: 103,913,316 G197S probably null Het
Olfr118 A T 17: 37,672,746 H241L probably benign Het
Olfr1395 T C 11: 49,148,995 M246T probably damaging Het
Pacs2 A G 12: 113,050,517 D196G probably benign Het
Pbxip1 A G 3: 89,443,705 D118G probably benign Het
Pcdhb11 A T 18: 37,421,476 probably benign Het
Pgk2 C T 17: 40,208,342 G65D probably damaging Het
Plcd3 T C 11: 103,079,634 D193G probably benign Het
Plcl2 T G 17: 50,608,099 M712R probably damaging Het
Plxna1 G A 6: 89,357,540 Q36* probably null Het
Plxnb2 A G 15: 89,167,812 V68A probably benign Het
Polr2b A G 5: 77,345,377 I1069V probably benign Het
Rbfox1 A G 16: 7,294,109 T200A probably benign Het
Serpinb6d T C 13: 33,671,222 M293T probably damaging Het
Slc4a8 A G 15: 100,783,032 R72G probably benign Het
Smarca5 A C 8: 80,719,715 L452W probably damaging Het
Srcin1 T C 11: 97,525,551 K952E probably damaging Het
Synpo2l G T 14: 20,666,670 Q79K possibly damaging Het
Tmem174 T C 13: 98,637,295 E9G possibly damaging Het
Tmem270 T C 5: 134,901,790 T206A probably damaging Het
Ttn T A 2: 76,732,607 T28668S possibly damaging Het
Vmn1r118 A T 7: 20,911,892 S152R possibly damaging Het
Vmn2r25 T A 6: 123,840,001 Q207L probably damaging Het
Vmn2r81 T A 10: 79,293,748 S824R probably damaging Het
Vps54 G A 11: 21,308,771 V733I probably benign Het
Zfp518b G T 5: 38,672,258 D801E probably benign Het
Zgrf1 C A 3: 127,598,779 P1316Q probably damaging Het
Other mutations in Rspry1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rspry1 APN 8 94622986 start codon destroyed probably null 0.89
IGL00158:Rspry1 APN 8 94622980 intron probably benign
IGL01141:Rspry1 APN 8 94649855 missense probably benign 0.00
IGL01860:Rspry1 APN 8 94649816 missense probably benign 0.00
IGL02174:Rspry1 APN 8 94633140 missense possibly damaging 0.84
IGL02819:Rspry1 APN 8 94654256 missense probably benign 0.42
IGL02926:Rspry1 APN 8 94649811 missense probably damaging 1.00
IGL03366:Rspry1 APN 8 94650334 missense probably benign 0.00
R0570:Rspry1 UTSW 8 94629792 missense probably damaging 1.00
R1833:Rspry1 UTSW 8 94635488 missense probably damaging 1.00
R1988:Rspry1 UTSW 8 94632054 critical splice acceptor site probably null
R2444:Rspry1 UTSW 8 94623107 missense probably damaging 1.00
R3623:Rspry1 UTSW 8 94649777 missense probably damaging 1.00
R3624:Rspry1 UTSW 8 94649777 missense probably damaging 1.00
R4275:Rspry1 UTSW 8 94649761 missense probably benign 0.00
R4888:Rspry1 UTSW 8 94658789 missense probably benign 0.19
R5026:Rspry1 UTSW 8 94650303 missense probably damaging 1.00
R5310:Rspry1 UTSW 8 94623185 missense probably benign
R5374:Rspry1 UTSW 8 94623008 missense probably benign 0.00
R5374:Rspry1 UTSW 8 94654264 missense probably benign 0.38
R5387:Rspry1 UTSW 8 94638286 missense possibly damaging 0.95
R5517:Rspry1 UTSW 8 94636760 splice site probably null
R5631:Rspry1 UTSW 8 94629078 start codon destroyed possibly damaging 0.79
R5653:Rspry1 UTSW 8 94636611 splice site probably null
R6065:Rspry1 UTSW 8 94622987 start codon destroyed probably null 0.98
R6220:Rspry1 UTSW 8 94658750 missense probably damaging 1.00
R6276:Rspry1 UTSW 8 94623258 missense probably damaging 1.00
R6821:Rspry1 UTSW 8 94635431 nonsense probably null
R7390:Rspry1 UTSW 8 94623185 missense probably benign
R7460:Rspry1 UTSW 8 94650335 missense probably benign 0.00
R7644:Rspry1 UTSW 8 94658768 missense probably benign 0.00
R7717:Rspry1 UTSW 8 94623122 missense probably damaging 1.00
R7768:Rspry1 UTSW 8 94629841 missense probably damaging 1.00
R7940:Rspry1 UTSW 8 94623007 missense probably benign 0.22
R7978:Rspry1 UTSW 8 94623125 missense probably damaging 0.98
R8087:Rspry1 UTSW 8 94654297 missense probably benign 0.04
R8174:Rspry1 UTSW 8 94649822 missense probably damaging 0.97
R8326:Rspry1 UTSW 8 94639589 missense probably damaging 1.00
R8676:Rspry1 UTSW 8 94632119 missense probably benign 0.01
R8715:Rspry1 UTSW 8 94623260 missense probably damaging 0.98
R8869:Rspry1 UTSW 8 94633152 missense probably damaging 0.97
R9281:Rspry1 UTSW 8 94636631 missense probably damaging 1.00
X0010:Rspry1 UTSW 8 94629801 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AGTGATTGAGTAGTCAAGACCTTC -3'
(R):5'- AGGGACTGTACTGTTCTCAGC -3'

Sequencing Primer
(F):5'- CTTTCTCTTTTCCTCTCTTGTAGAAC -3'
(R):5'- GACTGTACTGTTCTCAGCCTGTTG -3'
Posted On 2022-03-25