Incidental Mutation 'R9253:Olfr118'
ID 701687
Institutional Source Beutler Lab
Gene Symbol Olfr118
Ensembl Gene ENSMUSG00000080990
Gene Name olfactory receptor 118
Synonyms MOR263-13, GA_x6K02T2PSCP-2131124-2132089
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R9253 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 37666988-37673476 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 37672746 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 241 (H241L)
Ref Sequence ENSEMBL: ENSMUSP00000150176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122036] [ENSMUST00000215811] [ENSMUST00000216551]
AlphaFold Q7TRJ6
Predicted Effect probably benign
Transcript: ENSMUST00000122036
AA Change: H241L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113988
Gene: ENSMUSG00000080990
AA Change: H241L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 32 173 2e-6 PFAM
Pfam:7tm_4 37 314 2.1e-57 PFAM
Pfam:7TM_GPCR_Srsx 41 311 5.8e-6 PFAM
Pfam:7tm_1 47 296 1.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215811
AA Change: H241L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000216551
AA Change: H241L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.1533 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A G 18: 58,969,941 N685D probably damaging Het
Adh4 A T 3: 138,424,099 I229F probably damaging Het
Aldh3b1 T A 19: 3,915,315 S399C probably damaging Het
Arhgef28 C T 13: 97,988,271 G501D probably benign Het
Asb1 C A 1: 91,540,829 T6N unknown Het
Asb18 C T 1: 89,954,463 V382I probably benign Het
AU041133 T C 10: 82,151,386 I291T probably benign Het
B4galnt2 C T 11: 95,868,350 silent Het
Bcl7c T C 7: 127,707,231 probably benign Het
Brinp1 T C 4: 68,792,846 N375S possibly damaging Het
C6 A G 15: 4,735,197 Q125R probably benign Het
Card14 T C 11: 119,321,933 S108P probably benign Het
Clec4a2 C A 6: 123,123,649 T21N probably damaging Het
Cntnap2 C T 6: 46,001,178 L256F probably benign Het
Cobll1 G A 2: 65,151,159 T29I probably benign Het
Coq4 A T 2: 29,795,421 D149V probably damaging Het
Dync1i1 T C 6: 5,769,698 L91S probably benign Het
Fat2 T A 11: 55,310,571 D559V probably damaging Het
Gm4779 TGGCAGAGGCAGAGGCAGAGGCAGAGGCAGAGGCAG TGGCAGAGGCAGAGGCAGAGGCAGAGGCAGAGGCAGAGGCAG X: 101,793,311 probably benign Het
Gm996 T C 2: 25,577,160 H913R possibly damaging Het
Gsdmc A T 15: 63,804,558 V12E probably damaging Het
H2-Ab1 T C 17: 34,267,404 S146P probably damaging Het
Heatr5b A G 17: 78,827,994 V236A probably benign Het
Hfe2 T C 3: 96,528,394 S323P probably benign Het
Hmgcr C T 13: 96,660,137 C215Y probably damaging Het
L3mbtl1 G T 2: 162,947,712 A57S probably benign Het
Lilr4b G A 10: 51,481,767 V186I probably damaging Het
Map1a T C 2: 121,302,342 V1213A probably benign Het
Marf1 T C 16: 14,117,308 E1532G probably damaging Het
Mcm6 T C 1: 128,351,527 Y174C probably damaging Het
Miga2 T A 2: 30,371,227 V178E probably benign Het
Myh11 T A 16: 14,256,495 I174F Het
Ndufv1 G T 19: 4,009,412 A211E probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Nrp1 T C 8: 128,502,663 V874A possibly damaging Het
Nsf C T 11: 103,913,316 G197S probably null Het
Olfr1395 T C 11: 49,148,995 M246T probably damaging Het
Pacs2 A G 12: 113,050,517 D196G probably benign Het
Pbxip1 A G 3: 89,443,705 D118G probably benign Het
Pcdhb11 A T 18: 37,421,476 probably benign Het
Pgk2 C T 17: 40,208,342 G65D probably damaging Het
Plcd3 T C 11: 103,079,634 D193G probably benign Het
Plcl2 T G 17: 50,608,099 M712R probably damaging Het
Plxna1 G A 6: 89,357,540 Q36* probably null Het
Plxnb2 A G 15: 89,167,812 V68A probably benign Het
Polr2b A G 5: 77,345,377 I1069V probably benign Het
Rbfox1 A G 16: 7,294,109 T200A probably benign Het
Rspry1 T A 8: 94,622,993 V3D probably damaging Het
Serpinb6d T C 13: 33,671,222 M293T probably damaging Het
Slc4a8 A G 15: 100,783,032 R72G probably benign Het
Smarca5 A C 8: 80,719,715 L452W probably damaging Het
Srcin1 T C 11: 97,525,551 K952E probably damaging Het
Synpo2l G T 14: 20,666,670 Q79K possibly damaging Het
Tmem174 T C 13: 98,637,295 E9G possibly damaging Het
Tmem270 T C 5: 134,901,790 T206A probably damaging Het
Ttn T A 2: 76,732,607 T28668S possibly damaging Het
Vmn1r118 A T 7: 20,911,892 S152R possibly damaging Het
Vmn2r25 T A 6: 123,840,001 Q207L probably damaging Het
Vmn2r81 T A 10: 79,293,748 S824R probably damaging Het
Vps54 G A 11: 21,308,771 V733I probably benign Het
Zfp518b G T 5: 38,672,258 D801E probably benign Het
Zgrf1 C A 3: 127,598,779 P1316Q probably damaging Het
Zzef1 C A 11: 72,848,637 probably benign Het
Other mutations in Olfr118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Olfr118 APN 17 37672887 missense probably damaging 1.00
IGL02456:Olfr118 APN 17 37672449 missense possibly damaging 0.90
IGL02750:Olfr118 APN 17 37672609 nonsense probably null
IGL03083:Olfr118 APN 17 37672660 nonsense probably null
IGL03339:Olfr118 APN 17 37672557 missense possibly damaging 0.87
R0032:Olfr118 UTSW 17 37672487 missense probably damaging 1.00
R1457:Olfr118 UTSW 17 37672925 nonsense probably null
R1542:Olfr118 UTSW 17 37672251 missense probably damaging 1.00
R1771:Olfr118 UTSW 17 37672663 missense probably damaging 1.00
R1893:Olfr118 UTSW 17 37672856 nonsense probably null
R2395:Olfr118 UTSW 17 37672696 nonsense probably null
R3619:Olfr118 UTSW 17 37672640 missense probably benign 0.05
R3917:Olfr118 UTSW 17 37672793 missense probably damaging 1.00
R3937:Olfr118 UTSW 17 37672967 missense probably benign 0.01
R5600:Olfr118 UTSW 17 37672285 missense possibly damaging 0.91
R6415:Olfr118 UTSW 17 37672557 missense possibly damaging 0.87
R6462:Olfr118 UTSW 17 37672220 missense probably damaging 1.00
R7355:Olfr118 UTSW 17 37672410 missense probably benign 0.02
R7861:Olfr118 UTSW 17 37672517 missense possibly damaging 0.91
R7913:Olfr118 UTSW 17 37672108 missense probably benign
R7952:Olfr118 UTSW 17 37672817 missense probably damaging 1.00
R7969:Olfr118 UTSW 17 37672656 missense probably damaging 1.00
R8879:Olfr118 UTSW 17 37672411 nonsense probably null
R8923:Olfr118 UTSW 17 37672811 missense probably benign 0.00
R9778:Olfr118 UTSW 17 37672254 missense probably damaging 0.97
R9789:Olfr118 UTSW 17 37672168 missense probably damaging 1.00
RF003:Olfr118 UTSW 17 37672858 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGACCACTTCTTCTGTGACC -3'
(R):5'- TGCCCGAGATGTCTTCAGAC -3'

Sequencing Primer
(F):5'- GTGACCTTCCACCTGTCCTGG -3'
(R):5'- CCGAGATGTCTTCAGACTCAGAG -3'
Posted On 2022-03-25