Incidental Mutation 'R9253:Heatr5b'
ID 701690
Institutional Source Beutler Lab
Gene Symbol Heatr5b
Ensembl Gene ENSMUSG00000039414
Gene Name HEAT repeat containing 5B
Synonyms 2010013B10Rik, A230048G03Rik, D330050P16Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.535) question?
Stock # R9253 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 78752906-78835381 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 78827994 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 236 (V236A)
Ref Sequence ENSEMBL: ENSMUSP00000094882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097281]
AlphaFold Q8C547
Predicted Effect probably benign
Transcript: ENSMUST00000097281
AA Change: V236A

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000094882
Gene: ENSMUSG00000039414
AA Change: V236A

DomainStartEndE-ValueType
SCOP:d1qbkb_ 46 491 4e-6 SMART
SCOP:d1qbkb_ 846 1338 2e-16 SMART
low complexity region 1641 1650 N/A INTRINSIC
low complexity region 2039 2057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A G 18: 58,969,941 N685D probably damaging Het
Adh4 A T 3: 138,424,099 I229F probably damaging Het
Aldh3b1 T A 19: 3,915,315 S399C probably damaging Het
Arhgef28 C T 13: 97,988,271 G501D probably benign Het
Asb1 C A 1: 91,540,829 T6N unknown Het
Asb18 C T 1: 89,954,463 V382I probably benign Het
AU041133 T C 10: 82,151,386 I291T probably benign Het
Brinp1 T C 4: 68,792,846 N375S possibly damaging Het
C6 A G 15: 4,735,197 Q125R probably benign Het
Card14 T C 11: 119,321,933 S108P probably benign Het
Clec4a2 C A 6: 123,123,649 T21N probably damaging Het
Cntnap2 C T 6: 46,001,178 L256F probably benign Het
Cobll1 G A 2: 65,151,159 T29I probably benign Het
Coq4 A T 2: 29,795,421 D149V probably damaging Het
Dync1i1 T C 6: 5,769,698 L91S probably benign Het
Fat2 T A 11: 55,310,571 D559V probably damaging Het
Gm4779 TGGCAGAGGCAGAGGCAGAGGCAGAGGCAGAGGCAG TGGCAGAGGCAGAGGCAGAGGCAGAGGCAGAGGCAGAGGCAG X: 101,793,311 probably benign Het
Gm996 T C 2: 25,577,160 H913R possibly damaging Het
Gsdmc A T 15: 63,804,558 V12E probably damaging Het
H2-Ab1 T C 17: 34,267,404 S146P probably damaging Het
Hfe2 T C 3: 96,528,394 S323P probably benign Het
Hmgcr C T 13: 96,660,137 C215Y probably damaging Het
L3mbtl1 G T 2: 162,947,712 A57S probably benign Het
Lilr4b G A 10: 51,481,767 V186I probably damaging Het
Map1a T C 2: 121,302,342 V1213A probably benign Het
Marf1 T C 16: 14,117,308 E1532G probably damaging Het
Mcm6 T C 1: 128,351,527 Y174C probably damaging Het
Miga2 T A 2: 30,371,227 V178E probably benign Het
Myh11 T A 16: 14,256,495 I174F Het
Ndufv1 G T 19: 4,009,412 A211E probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Nrp1 T C 8: 128,502,663 V874A possibly damaging Het
Nsf C T 11: 103,913,316 G197S probably null Het
Olfr118 A T 17: 37,672,746 H241L probably benign Het
Olfr1395 T C 11: 49,148,995 M246T probably damaging Het
Pacs2 A G 12: 113,050,517 D196G probably benign Het
Pbxip1 A G 3: 89,443,705 D118G probably benign Het
Pcdhb11 A T 18: 37,421,476 probably benign Het
Pgk2 C T 17: 40,208,342 G65D probably damaging Het
Plcd3 T C 11: 103,079,634 D193G probably benign Het
Plcl2 T G 17: 50,608,099 M712R probably damaging Het
Plxna1 G A 6: 89,357,540 Q36* probably null Het
Plxnb2 A G 15: 89,167,812 V68A probably benign Het
Polr2b A G 5: 77,345,377 I1069V probably benign Het
Rbfox1 A G 16: 7,294,109 T200A probably benign Het
Rspry1 T A 8: 94,622,993 V3D probably damaging Het
Serpinb6d T C 13: 33,671,222 M293T probably damaging Het
Slc4a8 A G 15: 100,783,032 R72G probably benign Het
Smarca5 A C 8: 80,719,715 L452W probably damaging Het
Srcin1 T C 11: 97,525,551 K952E probably damaging Het
Synpo2l G T 14: 20,666,670 Q79K possibly damaging Het
Tmem174 T C 13: 98,637,295 E9G possibly damaging Het
Tmem270 T C 5: 134,901,790 T206A probably damaging Het
Ttn T A 2: 76,732,607 T28668S possibly damaging Het
Vmn1r118 A T 7: 20,911,892 S152R possibly damaging Het
Vmn2r25 T A 6: 123,840,001 Q207L probably damaging Het
Vmn2r81 T A 10: 79,293,748 S824R probably damaging Het
Vps54 G A 11: 21,308,771 V733I probably benign Het
Zfp518b G T 5: 38,672,258 D801E probably benign Het
Zgrf1 C A 3: 127,598,779 P1316Q probably damaging Het
Other mutations in Heatr5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Heatr5b APN 17 78803434 missense probably damaging 1.00
IGL00418:Heatr5b APN 17 78753141 missense probably damaging 1.00
IGL00786:Heatr5b APN 17 78824634 missense possibly damaging 0.95
IGL00840:Heatr5b APN 17 78765437 missense probably damaging 1.00
IGL01362:Heatr5b APN 17 78816338 splice site probably benign
IGL01419:Heatr5b APN 17 78796510 missense probably benign 0.19
IGL01447:Heatr5b APN 17 78829597 missense probably benign 0.00
IGL01591:Heatr5b APN 17 78808472 missense probably benign 0.01
IGL01743:Heatr5b APN 17 78824640 nonsense probably null
IGL01860:Heatr5b APN 17 78808480 missense probably damaging 0.98
IGL01862:Heatr5b APN 17 78796485 missense possibly damaging 0.96
IGL01984:Heatr5b APN 17 78796497 missense possibly damaging 0.63
IGL02045:Heatr5b APN 17 78808426 missense probably damaging 1.00
IGL02097:Heatr5b APN 17 78817514 missense probably damaging 1.00
IGL02168:Heatr5b APN 17 78831591 unclassified probably benign
IGL02399:Heatr5b APN 17 78827967 missense probably damaging 0.99
IGL02540:Heatr5b APN 17 78773572 missense probably damaging 1.00
IGL02719:Heatr5b APN 17 78815540 missense probably damaging 1.00
IGL02824:Heatr5b APN 17 78773680 missense probably damaging 1.00
IGL02965:Heatr5b APN 17 78753073 missense probably benign 0.37
IGL03032:Heatr5b APN 17 78760499 missense probably benign 0.45
IGL03243:Heatr5b APN 17 78763080 splice site probably benign
IGL03259:Heatr5b APN 17 78791556 missense probably damaging 1.00
IGL03349:Heatr5b APN 17 78755320 missense probably benign 0.01
R5470_heatr5b_501 UTSW 17 78821579 splice site probably null
R0124:Heatr5b UTSW 17 78826217 splice site probably benign
R0285:Heatr5b UTSW 17 78808453 missense probably benign 0.05
R0335:Heatr5b UTSW 17 78827946 missense probably benign 0.15
R0412:Heatr5b UTSW 17 78820854 missense probably benign 0.04
R0601:Heatr5b UTSW 17 78768545 missense probably benign
R0725:Heatr5b UTSW 17 78796396 missense probably benign 0.03
R1178:Heatr5b UTSW 17 78813269 missense probably damaging 1.00
R1444:Heatr5b UTSW 17 78753193 missense probably benign 0.17
R1444:Heatr5b UTSW 17 78755427 splice site probably benign
R1453:Heatr5b UTSW 17 78817563 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1506:Heatr5b UTSW 17 78753147 missense probably damaging 1.00
R1819:Heatr5b UTSW 17 78791511 missense probably damaging 0.98
R1835:Heatr5b UTSW 17 78773563 missense probably damaging 1.00
R1837:Heatr5b UTSW 17 78820751 missense possibly damaging 0.54
R1934:Heatr5b UTSW 17 78795918 missense possibly damaging 0.93
R2014:Heatr5b UTSW 17 78814184 missense probably damaging 1.00
R2037:Heatr5b UTSW 17 78829505 nonsense probably null
R2154:Heatr5b UTSW 17 78831444 missense probably benign 0.00
R2190:Heatr5b UTSW 17 78801756 missense probably damaging 1.00
R2191:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R2413:Heatr5b UTSW 17 78756861 critical splice donor site probably null
R3424:Heatr5b UTSW 17 78768404 missense possibly damaging 0.58
R3607:Heatr5b UTSW 17 78834217 missense probably damaging 1.00
R3759:Heatr5b UTSW 17 78824540 missense possibly damaging 0.94
R3761:Heatr5b UTSW 17 78829642 missense probably damaging 1.00
R4127:Heatr5b UTSW 17 78753174 missense possibly damaging 0.48
R4242:Heatr5b UTSW 17 78756922 missense probably benign 0.00
R4345:Heatr5b UTSW 17 78760511 missense possibly damaging 0.94
R4534:Heatr5b UTSW 17 78810596 missense possibly damaging 0.91
R4623:Heatr5b UTSW 17 78795119 missense possibly damaging 0.52
R4654:Heatr5b UTSW 17 78820701 missense possibly damaging 0.95
R4939:Heatr5b UTSW 17 78762260 missense probably benign 0.18
R4960:Heatr5b UTSW 17 78831584 missense probably benign 0.01
R5037:Heatr5b UTSW 17 78824510 missense probably benign 0.00
R5051:Heatr5b UTSW 17 78795274 missense probably damaging 1.00
R5153:Heatr5b UTSW 17 78795107 nonsense probably null
R5328:Heatr5b UTSW 17 78826362 missense possibly damaging 0.94
R5346:Heatr5b UTSW 17 78827986 missense probably benign 0.44
R5426:Heatr5b UTSW 17 78773713 missense probably damaging 1.00
R5470:Heatr5b UTSW 17 78821579 splice site probably null
R5472:Heatr5b UTSW 17 78801660 missense probably damaging 1.00
R5553:Heatr5b UTSW 17 78753351 splice site probably null
R5706:Heatr5b UTSW 17 78766875 splice site probably null
R5804:Heatr5b UTSW 17 78831522 missense probably damaging 0.97
R5978:Heatr5b UTSW 17 78806036 missense probably damaging 0.99
R6122:Heatr5b UTSW 17 78813173 missense possibly damaging 0.96
R6153:Heatr5b UTSW 17 78831441 missense possibly damaging 0.56
R6220:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R6221:Heatr5b UTSW 17 78766954 missense probably benign 0.05
R6255:Heatr5b UTSW 17 78803434 missense probably damaging 1.00
R6291:Heatr5b UTSW 17 78762097 missense probably benign 0.08
R6455:Heatr5b UTSW 17 78753073 missense probably benign 0.37
R6524:Heatr5b UTSW 17 78814106 missense possibly damaging 0.94
R6575:Heatr5b UTSW 17 78762989 missense probably damaging 1.00
R6899:Heatr5b UTSW 17 78803509 missense probably benign 0.03
R7084:Heatr5b UTSW 17 78810563 missense possibly damaging 0.68
R7138:Heatr5b UTSW 17 78827988 missense probably damaging 1.00
R7148:Heatr5b UTSW 17 78831434 missense probably damaging 0.99
R7382:Heatr5b UTSW 17 78803507 missense possibly damaging 0.64
R7420:Heatr5b UTSW 17 78808480 missense probably damaging 1.00
R7436:Heatr5b UTSW 17 78768533 missense probably benign
R7519:Heatr5b UTSW 17 78755217 missense probably benign
R7606:Heatr5b UTSW 17 78763026 missense probably benign
R7673:Heatr5b UTSW 17 78795983 missense probably damaging 0.97
R7782:Heatr5b UTSW 17 78795941 missense probably damaging 0.99
R7790:Heatr5b UTSW 17 78818823 missense probably damaging 0.99
R7922:Heatr5b UTSW 17 78760559 missense probably benign 0.01
R8184:Heatr5b UTSW 17 78814233 missense probably benign 0.03
R8222:Heatr5b UTSW 17 78801701 missense possibly damaging 0.95
R8276:Heatr5b UTSW 17 78791539 nonsense probably null
R8324:Heatr5b UTSW 17 78755364 missense possibly damaging 0.85
R8430:Heatr5b UTSW 17 78829624 missense probably damaging 0.97
R8432:Heatr5b UTSW 17 78803501 missense probably damaging 0.99
R8672:Heatr5b UTSW 17 78762203 missense probably damaging 1.00
R8781:Heatr5b UTSW 17 78795309 missense probably benign 0.19
R8794:Heatr5b UTSW 17 78815586 missense probably benign 0.00
R8808:Heatr5b UTSW 17 78765405 missense possibly damaging 0.92
R8850:Heatr5b UTSW 17 78801759 missense probably benign 0.02
R8893:Heatr5b UTSW 17 78761995 splice site probably benign
R9010:Heatr5b UTSW 17 78773710 missense probably damaging 1.00
R9041:Heatr5b UTSW 17 78796432 missense probably benign 0.12
R9150:Heatr5b UTSW 17 78796019 missense probably benign
R9318:Heatr5b UTSW 17 78765402 missense probably benign 0.07
R9448:Heatr5b UTSW 17 78760586 missense probably benign 0.26
R9489:Heatr5b UTSW 17 78753250 nonsense probably null
X0022:Heatr5b UTSW 17 78760545 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CTAACAATTTAAGTGCCTTTAAAGTGG -3'
(R):5'- TGCTGACCCTGTTTCTTGTGTTA -3'

Sequencing Primer
(F):5'- GTGGCCTCCATGCGTAATAAC -3'
(R):5'- CAGTACCTTGCACAGTGTAGGAC -3'
Posted On 2022-03-25