Mutagenetix > Incidental Mutation

Incidental Mutation 'R9253:Adamts19'

701692

Institutional Source

Beutler Lab

Gene Symbol

Adamts19

Ensembl Gene

ENSMUSG00000053441

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19

Synonyms

D230034E10Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9253 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58836764-59053678 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 58969941 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 685 (N685D)

Ref Sequence

ENSEMBL: ENSMUSP00000050535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052907]

AlphaFold

P59509

Predicted Effect

probably damaging
Transcript: ENSMUST00000052907
AA Change: N685D

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: N685D

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	57	84	N/A	INTRINSIC
low complexity region	109	124	N/A	INTRINSIC
Pfam:Pep_M12B_propep	131	276	1.6e-21	PFAM
Pfam:Reprolysin_5	326	523	1.7e-13	PFAM
Pfam:Reprolysin_4	328	544	2e-10	PFAM
Pfam:Reprolysin	328	548	9e-22	PFAM
Pfam:Reprolysin_2	346	537	1.6e-9	PFAM
Pfam:Reprolysin_3	350	496	3.4e-12	PFAM
low complexity region	551	562	N/A	INTRINSIC
TSP1	639	689	5.68e-9	SMART
Pfam:ADAM_spacer1	793	903	1.1e-31	PFAM
TSP1	922	980	4.95e-2	SMART
TSP1	982	1040	4.95e-2	SMART
TSP1	1042	1086	1.62e-4	SMART
TSP1	1093	1147	1.03e-6	SMART
Pfam:PLAC	1167	1199	4.2e-9	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adh4	A	T	3: 138,424,099	I229F	probably damaging	Het
Aldh3b1	T	A	19: 3,915,315	S399C	probably damaging	Het
Arhgef28	C	T	13: 97,988,271	G501D	probably benign	Het
Asb1	C	A	1: 91,540,829	T6N	unknown	Het
Asb18	C	T	1: 89,954,463	V382I	probably benign	Het
AU041133	T	C	10: 82,151,386	I291T	probably benign	Het
B4galnt2	C	T	11: 95,868,350		silent	Het
Bcl7c	T	C	7: 127,707,231		probably benign	Het
Brinp1	T	C	4: 68,792,846	N375S	possibly damaging	Het
C6	A	G	15: 4,735,197	Q125R	probably benign	Het
Card14	T	C	11: 119,321,933	S108P	probably benign	Het
Clec4a2	C	A	6: 123,123,649	T21N	probably damaging	Het
Cntnap2	C	T	6: 46,001,178	L256F	probably benign	Het
Cobll1	G	A	2: 65,151,159	T29I	probably benign	Het
Coq4	A	T	2: 29,795,421	D149V	probably damaging	Het
Dync1i1	T	C	6: 5,769,698	L91S	probably benign	Het
Fat2	T	A	11: 55,310,571	D559V	probably damaging	Het
Gm4779	TGGCAGAGGCAGAGGCAGAGGCAGAGGCAGAGGCAG	TGGCAGAGGCAGAGGCAGAGGCAGAGGCAGAGGCAGAGGCAG	X: 101,793,311		probably benign	Het
Gm996	T	C	2: 25,577,160	H913R	possibly damaging	Het
Gsdmc	A	T	15: 63,804,558	V12E	probably damaging	Het
H2-Ab1	T	C	17: 34,267,404	S146P	probably damaging	Het
Heatr5b	A	G	17: 78,827,994	V236A	probably benign	Het
Hfe2	T	C	3: 96,528,394	S323P	probably benign	Het
Hmgcr	C	T	13: 96,660,137	C215Y	probably damaging	Het
L3mbtl1	G	T	2: 162,947,712	A57S	probably benign	Het
Lilr4b	G	A	10: 51,481,767	V186I	probably damaging	Het
Map1a	T	C	2: 121,302,342	V1213A	probably benign	Het
Marf1	T	C	16: 14,117,308	E1532G	probably damaging	Het
Mcm6	T	C	1: 128,351,527	Y174C	probably damaging	Het
Miga2	T	A	2: 30,371,227	V178E	probably benign	Het
Myh11	T	A	16: 14,256,495	I174F		Het
Ndufv1	G	T	19: 4,009,412	A211E	probably damaging	Het
Nicn1	C	T	9: 108,294,509	R163C	possibly damaging	Het
Nlgn3	T	C	X: 101,308,784	V179A	probably damaging	Het
Nrp1	T	C	8: 128,502,663	V874A	possibly damaging	Het
Nsf	C	T	11: 103,913,316	G197S	probably null	Het
Olfr118	A	T	17: 37,672,746	H241L	probably benign	Het
Olfr1395	T	C	11: 49,148,995	M246T	probably damaging	Het
Pacs2	A	G	12: 113,050,517	D196G	probably benign	Het
Pbxip1	A	G	3: 89,443,705	D118G	probably benign	Het
Pcdhb11	A	T	18: 37,421,476		probably benign	Het
Pgk2	C	T	17: 40,208,342	G65D	probably damaging	Het
Plcd3	T	C	11: 103,079,634	D193G	probably benign	Het
Plcl2	T	G	17: 50,608,099	M712R	probably damaging	Het
Plxna1	G	A	6: 89,357,540	Q36*	probably null	Het
Plxnb2	A	G	15: 89,167,812	V68A	probably benign	Het
Polr2b	A	G	5: 77,345,377	I1069V	probably benign	Het
Rbfox1	A	G	16: 7,294,109	T200A	probably benign	Het
Rspry1	T	A	8: 94,622,993	V3D	probably damaging	Het
Serpinb6d	T	C	13: 33,671,222	M293T	probably damaging	Het
Slc4a8	A	G	15: 100,783,032	R72G	probably benign	Het
Smarca5	A	C	8: 80,719,715	L452W	probably damaging	Het
Srcin1	T	C	11: 97,525,551	K952E	probably damaging	Het
Synpo2l	G	T	14: 20,666,670	Q79K	possibly damaging	Het
Tmem174	T	C	13: 98,637,295	E9G	possibly damaging	Het
Tmem270	T	C	5: 134,901,790	T206A	probably damaging	Het
Ttn	T	A	2: 76,732,607	T28668S	possibly damaging	Het
Vmn1r118	A	T	7: 20,911,892	S152R	possibly damaging	Het
Vmn2r25	T	A	6: 123,840,001	Q207L	probably damaging	Het
Vmn2r81	T	A	10: 79,293,748	S824R	probably damaging	Het
Vps54	G	A	11: 21,308,771	V733I	probably benign	Het
Zfp518b	G	T	5: 38,672,258	D801E	probably benign	Het
Zgrf1	C	A	3: 127,598,779	P1316Q	probably damaging	Het
Zzef1	C	A	11: 72,848,637		probably benign	Het

Other mutations in Adamts19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Adamts19	APN	18	59024465	missense	probably damaging	1.00
IGL00331:Adamts19	APN	18	59007325	splice site	probably benign
IGL00970:Adamts19	APN	18	59011077	missense	possibly damaging	0.82
IGL01328:Adamts19	APN	18	59048882	missense	possibly damaging	0.89
IGL01385:Adamts19	APN	18	58972779	missense	probably damaging	0.98
IGL01529:Adamts19	APN	18	58963463	missense	probably damaging	0.99
IGL01535:Adamts19	APN	18	58968819	missense	probably benign	0.00
IGL01557:Adamts19	APN	18	58968720	splice site	probably null
IGL01705:Adamts19	APN	18	59032966	missense	possibly damaging	0.91
IGL01803:Adamts19	APN	18	58952469	missense	probably damaging	1.00
IGL02116:Adamts19	APN	18	58837499	missense	probably benign
IGL02131:Adamts19	APN	18	59052660	missense	probably damaging	1.00
IGL02312:Adamts19	APN	18	58927297	missense	probably damaging	1.00
IGL02755:Adamts19	APN	18	58969933	missense	probably benign	0.25
IGL02866:Adamts19	APN	18	59048842	missense	possibly damaging	0.80
IGL02964:Adamts19	APN	18	58988965	missense	probably damaging	1.00
IGL02982:Adamts19	APN	18	59024518	missense	probably damaging	1.00
IGL03040:Adamts19	APN	18	58903008	missense	probably benign	0.05
R0081:Adamts19	UTSW	18	58903065	critical splice donor site	probably null
R0194:Adamts19	UTSW	18	59011148	missense	probably null	1.00
R0195:Adamts19	UTSW	18	58969870	splice site	probably benign
R0541:Adamts19	UTSW	18	58927300	critical splice donor site	probably null
R0659:Adamts19	UTSW	18	59007493	splice site	probably benign
R0967:Adamts19	UTSW	18	58972740	nonsense	probably null
R1512:Adamts19	UTSW	18	59048845	missense	possibly damaging	0.89
R1536:Adamts19	UTSW	18	59052615	missense	probably damaging	1.00
R1582:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R1629:Adamts19	UTSW	18	58954619	missense	probably damaging	0.97
R1653:Adamts19	UTSW	18	58890293	missense	probably benign	0.00
R1718:Adamts19	UTSW	18	58972825	missense	probably damaging	1.00
R1733:Adamts19	UTSW	18	59031929	missense	probably damaging	1.00
R1753:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R1776:Adamts19	UTSW	18	58954620	missense	probably damaging	1.00
R1905:Adamts19	UTSW	18	59032945	missense	possibly damaging	0.92
R1958:Adamts19	UTSW	18	58970006	missense	probably benign	0.09
R1994:Adamts19	UTSW	18	58972831	critical splice donor site	probably null
R2177:Adamts19	UTSW	18	58954554	missense	possibly damaging	0.66
R3730:Adamts19	UTSW	18	58900910	missense	probably damaging	1.00
R4342:Adamts19	UTSW	18	58942500	missense	probably damaging	1.00
R4772:Adamts19	UTSW	18	58837776	missense	possibly damaging	0.85
R4822:Adamts19	UTSW	18	58890284	missense	probably damaging	1.00
R4891:Adamts19	UTSW	18	59033000	missense	probably damaging	1.00
R5112:Adamts19	UTSW	18	59031804	nonsense	probably null
R5116:Adamts19	UTSW	18	58902994	missense	possibly damaging	0.52
R5205:Adamts19	UTSW	18	58968808	missense	probably damaging	1.00
R5765:Adamts19	UTSW	18	59052582	missense	probably damaging	1.00
R5781:Adamts19	UTSW	18	58837968	missense	possibly damaging	0.59
R5792:Adamts19	UTSW	18	58837512	missense	possibly damaging	0.49
R6082:Adamts19	UTSW	18	58968774	missense	probably benign	0.18
R6088:Adamts19	UTSW	18	58902102	missense	probably damaging	1.00
R7060:Adamts19	UTSW	18	58837640	nonsense	probably null
R7251:Adamts19	UTSW	18	58837902	missense	probably damaging	1.00
R7295:Adamts19	UTSW	18	58837883	missense	probably damaging	1.00
R7974:Adamts19	UTSW	18	59011022	missense	possibly damaging	0.72
R7991:Adamts19	UTSW	18	59052654	missense	probably damaging	1.00
R8129:Adamts19	UTSW	18	59007487	critical splice donor site	probably null
R8297:Adamts19	UTSW	18	58837848	missense	probably damaging	1.00
R8336:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R8358:Adamts19	UTSW	18	59048809	missense	probably damaging	1.00
R8864:Adamts19	UTSW	18	58890425	nonsense	probably null
R9051:Adamts19	UTSW	18	58900976	missense	probably damaging	1.00
R9423:Adamts19	UTSW	18	58890355	missense	possibly damaging	0.89
R9610:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9611:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9686:Adamts19	UTSW	18	58838021	missense	probably benign	0.00
R9697:Adamts19	UTSW	18	58968762	missense	probably damaging	0.99
R9747:Adamts19	UTSW	18	58890415	missense	possibly damaging	0.69
Z1177:Adamts19	UTSW	18	58838075	missense	probably damaging	1.00
Z1177:Adamts19	UTSW	18	58890374	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- TGCATGCCCGTGCTTTTAGAG -3'
(R):5'- TGTTATATGCCAGTGAGGTCAG -3'

Sequencing Primer
(F):5'- GCTTTTAGAGAAGCAGTCTAATAG -3'
(R):5'- CTTGCCACTGAAGTGCAT -3'

Posted On

2022-03-25