Incidental Mutation 'R9254:Abtb2'
ID 701706
Institutional Source Beutler Lab
Gene Symbol Abtb2
Ensembl Gene ENSMUSG00000032724
Gene Name ankyrin repeat and BTB domain containing 2
Synonyms BPOZ-2
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9254 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 103396655-103548768 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103541580 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 828 (T828A)
Ref Sequence ENSEMBL: ENSMUSP00000075566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076212]
AlphaFold Q7TQI7
Predicted Effect probably benign
Transcript: ENSMUST00000076212
AA Change: T828A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724
AA Change: T828A

DomainStartEndE-ValueType
low complexity region 29 48 N/A INTRINSIC
low complexity region 122 143 N/A INTRINSIC
Blast:H2A 186 301 2e-38 BLAST
low complexity region 366 376 N/A INTRINSIC
ANK 521 550 4.78e-7 SMART
ANK 567 596 6.26e-2 SMART
ANK 606 635 3.65e-3 SMART
ANK 649 678 5.52e2 SMART
ANK 715 746 1.84e3 SMART
BTB 844 946 9.15e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 A G 6: 86,914,049 (GRCm39) I173V possibly damaging Het
Abca14 G T 7: 119,807,202 (GRCm39) E83* probably null Het
Abcc5 T C 16: 20,152,437 (GRCm39) T1370A probably damaging Het
Agap1 T A 1: 89,653,741 (GRCm39) V370D probably damaging Het
Ankhd1 T C 18: 36,777,680 (GRCm39) V1621A probably benign Het
Atp2a2 T C 5: 122,611,315 (GRCm39) I168V probably benign Het
Atxn2 G A 5: 121,885,509 (GRCm39) V239I probably damaging Het
B230219D22Rik C A 13: 55,847,283 (GRCm39) A132E probably damaging Het
Bod1l T C 5: 41,979,223 (GRCm39) E697G probably damaging Het
Ccdc162 T G 10: 41,488,944 (GRCm39) probably null Het
Chd7 A G 4: 8,752,210 (GRCm39) S236G unknown Het
Csmd2 A G 4: 128,091,112 (GRCm39) E217G Het
Cyp2j7 T A 4: 96,105,740 (GRCm39) K257* probably null Het
D630003M21Rik C T 2: 158,042,883 (GRCm39) A886T probably damaging Het
D630044L22Rik A G 17: 26,180,856 (GRCm39) H102R possibly damaging Het
Dact3 G A 7: 16,620,013 (GRCm39) V503I unknown Het
Dcn G T 10: 97,343,643 (GRCm39) R201L probably damaging Het
Dmxl1 T C 18: 50,024,567 (GRCm39) V1747A possibly damaging Het
Dnajc14 T A 10: 128,652,743 (GRCm39) probably null Het
Dner A G 1: 84,673,193 (GRCm39) V86A probably benign Het
Dspp A T 5: 104,322,760 (GRCm39) probably null Het
Gphn T C 12: 78,674,036 (GRCm39) probably null Het
Gpr158 A G 2: 21,373,042 (GRCm39) probably benign Het
Grip1 G T 10: 119,780,961 (GRCm39) L203F probably damaging Het
Hgfac T C 5: 35,202,133 (GRCm39) W345R probably damaging Het
Hoga1 T C 19: 42,051,697 (GRCm39) L250P probably damaging Het
Ighv1-24 T C 12: 114,736,663 (GRCm39) Y79C possibly damaging Het
Katnip T C 7: 125,469,848 (GRCm39) L1439P probably damaging Het
Kif21a C T 15: 90,854,030 (GRCm39) R779Q probably damaging Het
Klkb1 T C 8: 45,742,067 (GRCm39) T71A probably benign Het
Lama2 A G 10: 27,298,685 (GRCm39) V137A probably damaging Het
Lrp2 T C 2: 69,333,891 (GRCm39) D1450G probably benign Het
Lrrc8c T A 5: 105,756,356 (GRCm39) Y710* probably null Het
Mixl1 A G 1: 180,522,258 (GRCm39) S208P probably benign Het
Mroh1 A G 15: 76,292,215 (GRCm39) H229R probably benign Het
Muc16 T A 9: 18,557,467 (GRCm39) Q2942L unknown Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nos1 G C 5: 118,017,402 (GRCm39) R255P probably benign Het
Nup85 T C 11: 115,469,424 (GRCm39) I322T probably benign Het
Odad1 A G 7: 45,597,116 (GRCm39) T456A probably benign Het
Odad2 T C 18: 7,265,089 (GRCm39) D426G possibly damaging Het
Or10n7-ps1 A G 9: 39,598,114 (GRCm39) L42P probably damaging Het
Or5w15 T A 2: 87,568,372 (GRCm39) M99L probably benign Het
Or7e169 T A 9: 19,757,212 (GRCm39) K234N possibly damaging Het
Or8b4 C T 9: 37,830,447 (GRCm39) L165F probably damaging Het
Or9k2b A G 10: 130,016,605 (GRCm39) M48T possibly damaging Het
Pcyt1a G A 16: 32,288,894 (GRCm39) R245Q probably benign Het
Pi15 T C 1: 17,695,180 (GRCm39) Y266H probably benign Het
Plxna2 C T 1: 194,492,474 (GRCm39) T1777I probably damaging Het
Ppp3cb T C 14: 20,581,874 (GRCm39) D47G probably benign Het
Pram1 T C 17: 33,860,441 (GRCm39) V336A probably damaging Het
Prl T A 13: 27,243,503 (GRCm39) I58N probably damaging Het
Qrich2 T C 11: 116,348,934 (GRCm39) D630G unknown Het
Ralgapa1 G C 12: 55,769,583 (GRCm39) P803A probably damaging Het
Rin1 A G 19: 5,103,249 (GRCm39) K513E probably damaging Het
Rtcb A T 10: 85,779,071 (GRCm39) probably null Het
Ryr2 C T 13: 11,898,002 (GRCm39) C131Y probably damaging Het
Sspo G T 6: 48,464,928 (GRCm39) V3954L probably damaging Het
Taf4b C T 18: 14,946,431 (GRCm39) T418M probably damaging Het
Taf6 A G 5: 138,181,952 (GRCm39) I92T possibly damaging Het
Tfg A T 16: 56,526,050 (GRCm39) D64E probably damaging Het
Tkfc T A 19: 10,574,712 (GRCm39) E176V probably damaging Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tmem200a A T 10: 25,869,654 (GRCm39) L205Q probably damaging Het
Trav13n-3 T G 14: 53,574,853 (GRCm39) L32V probably damaging Het
Tsen2 T A 6: 115,553,864 (GRCm39) M414K probably damaging Het
Tut7 T C 13: 59,936,288 (GRCm39) Y1271C possibly damaging Het
Txlna A T 4: 129,530,900 (GRCm39) Y196N probably damaging Het
Usp44 T A 10: 93,688,635 (GRCm39) I562K possibly damaging Het
Vmn1r24 T A 6: 57,932,736 (GRCm39) I261F probably benign Het
Vmn2r106 T C 17: 20,496,066 (GRCm39) T553A probably damaging Het
Vmn2r65 A G 7: 84,596,650 (GRCm39) V135A probably damaging Het
Other mutations in Abtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Abtb2 APN 2 103,535,463 (GRCm39) missense probably benign 0.00
IGL02605:Abtb2 APN 2 103,547,602 (GRCm39) missense probably benign
IGL03161:Abtb2 APN 2 103,397,799 (GRCm39) missense probably benign 0.02
PIT4504001:Abtb2 UTSW 2 103,547,537 (GRCm39) nonsense probably null
R0147:Abtb2 UTSW 2 103,397,480 (GRCm39) missense probably benign 0.04
R1052:Abtb2 UTSW 2 103,535,417 (GRCm39) missense possibly damaging 0.46
R1419:Abtb2 UTSW 2 103,539,765 (GRCm39) missense probably benign 0.00
R1518:Abtb2 UTSW 2 103,539,629 (GRCm39) missense probably benign 0.03
R1650:Abtb2 UTSW 2 103,532,747 (GRCm39) missense probably damaging 1.00
R1795:Abtb2 UTSW 2 103,397,369 (GRCm39) missense probably benign 0.00
R2054:Abtb2 UTSW 2 103,535,462 (GRCm39) missense probably benign 0.41
R2101:Abtb2 UTSW 2 103,397,207 (GRCm39) missense probably benign 0.05
R2363:Abtb2 UTSW 2 103,397,528 (GRCm39) missense probably damaging 1.00
R3440:Abtb2 UTSW 2 103,397,577 (GRCm39) missense probably benign 0.43
R3927:Abtb2 UTSW 2 103,538,563 (GRCm39) splice site probably null
R4351:Abtb2 UTSW 2 103,513,738 (GRCm39) missense possibly damaging 0.46
R4352:Abtb2 UTSW 2 103,513,738 (GRCm39) missense possibly damaging 0.46
R4782:Abtb2 UTSW 2 103,547,644 (GRCm39) missense probably benign 0.35
R4814:Abtb2 UTSW 2 103,547,632 (GRCm39) missense probably benign 0.08
R4831:Abtb2 UTSW 2 103,513,820 (GRCm39) missense probably benign 0.06
R4900:Abtb2 UTSW 2 103,397,349 (GRCm39) missense possibly damaging 0.62
R5038:Abtb2 UTSW 2 103,397,408 (GRCm39) missense probably damaging 0.99
R5513:Abtb2 UTSW 2 103,539,623 (GRCm39) critical splice acceptor site probably null
R6119:Abtb2 UTSW 2 103,532,655 (GRCm39) missense probably benign 0.00
R6298:Abtb2 UTSW 2 103,539,833 (GRCm39) missense probably benign 0.10
R6383:Abtb2 UTSW 2 103,397,721 (GRCm39) missense probably damaging 0.98
R6860:Abtb2 UTSW 2 103,539,770 (GRCm39) nonsense probably null
R7000:Abtb2 UTSW 2 103,542,787 (GRCm39) missense possibly damaging 0.85
R7109:Abtb2 UTSW 2 103,545,860 (GRCm39) missense probably benign 0.20
R7176:Abtb2 UTSW 2 103,539,720 (GRCm39) missense probably benign 0.00
R7189:Abtb2 UTSW 2 103,397,861 (GRCm39) missense probably benign 0.00
R7199:Abtb2 UTSW 2 103,397,565 (GRCm39) missense possibly damaging 0.74
R7299:Abtb2 UTSW 2 103,532,769 (GRCm39) splice site probably null
R7347:Abtb2 UTSW 2 103,397,757 (GRCm39) missense probably damaging 1.00
R7469:Abtb2 UTSW 2 103,397,292 (GRCm39) missense probably benign 0.00
R7629:Abtb2 UTSW 2 103,513,838 (GRCm39) critical splice donor site probably null
R7862:Abtb2 UTSW 2 103,532,626 (GRCm39) missense probably damaging 1.00
R8200:Abtb2 UTSW 2 103,531,162 (GRCm39) missense probably benign 0.02
R8682:Abtb2 UTSW 2 103,397,720 (GRCm39) missense probably benign 0.36
R8700:Abtb2 UTSW 2 103,397,289 (GRCm39) missense probably damaging 0.99
R9164:Abtb2 UTSW 2 103,541,829 (GRCm39) missense possibly damaging 0.50
R9196:Abtb2 UTSW 2 103,513,647 (GRCm39) missense possibly damaging 0.71
R9258:Abtb2 UTSW 2 103,546,410 (GRCm39) missense probably null 0.99
R9343:Abtb2 UTSW 2 103,547,505 (GRCm39) missense probably benign
R9427:Abtb2 UTSW 2 103,531,244 (GRCm39) missense probably damaging 1.00
R9675:Abtb2 UTSW 2 103,538,532 (GRCm39) missense probably benign
Z1176:Abtb2 UTSW 2 103,538,517 (GRCm39) nonsense probably null
Z1177:Abtb2 UTSW 2 103,541,541 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTGTTCTGGCCAACAAGC -3'
(R):5'- TTCAGAAAGTGAGGATCTGTGG -3'

Sequencing Primer
(F):5'- ACAAGCCTGATGTAGCTGC -3'
(R):5'- CAAGATAGTGTCAGGGTATCAACC -3'
Posted On 2022-03-25