Mutagenetix > Incidental Mutation

Incidental Mutation 'R9254:Abtb2'

701706

Institutional Source

Beutler Lab

Gene Symbol

Abtb2

Ensembl Gene

ENSMUSG00000032724

Gene Name

ankyrin repeat and BTB (POZ) domain containing 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9254 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

103566310-103718423 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 103711235 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 828 (T828A)

Ref Sequence

ENSEMBL: ENSMUSP00000075566 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076212]

AlphaFold

Q7TQI7

Predicted Effect

probably benign
Transcript: ENSMUST00000076212
AA Change: T828A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724
AA Change: T828A

Domain	Start	End	E-Value	Type
low complexity region	29	48	N/A	INTRINSIC
low complexity region	122	143	N/A	INTRINSIC
Blast:H2A	186	301	2e-38	BLAST
low complexity region	366	376	N/A	INTRINSIC
ANK	521	550	4.78e-7	SMART
ANK	567	596	6.26e-2	SMART
ANK	606	635	3.65e-3	SMART
ANK	649	678	5.52e2	SMART
ANK	715	746	1.84e3	SMART
BTB	844	946	9.15e-24	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	A	G	6: 86,937,067	I173V	possibly damaging	Het
Abca14	G	T	7: 120,207,979	E83*	probably null	Het
Abcc5	T	C	16: 20,333,687	T1370A	probably damaging	Het
Agap1	T	A	1: 89,726,019	V370D	probably damaging	Het
Ankhd1	T	C	18: 36,644,627	V1621A	probably benign	Het
Armc4	T	C	18: 7,265,089	D426G	possibly damaging	Het
Atp2a2	T	C	5: 122,473,252	I168V	probably benign	Het
Atxn2	G	A	5: 121,747,446	V239I	probably damaging	Het
B230219D22Rik	C	A	13: 55,699,470	A132E	probably damaging	Het
Bod1l	T	C	5: 41,821,880	E697G	probably damaging	Het
Ccdc114	A	G	7: 45,947,692	T456A	probably benign	Het
Ccdc162	T	G	10: 41,612,948		probably null	Het
Chd7	A	G	4: 8,752,210	S236G	unknown	Het
Csmd2	A	G	4: 128,197,319	E217G		Het
Cyp2j7	T	A	4: 96,217,503	K257*	probably null	Het
D430042O09Rik	T	C	7: 125,870,676	L1439P	probably damaging	Het
D630003M21Rik	C	T	2: 158,200,963	A886T	probably damaging	Het
D630044L22Rik	A	G	17: 25,961,882	H102R	possibly damaging	Het
Dact3	G	A	7: 16,886,088	V503I	unknown	Het
Dcn	G	T	10: 97,507,781	R201L	probably damaging	Het
Dmxl1	T	C	18: 49,891,500	V1747A	possibly damaging	Het
Dnajc14	T	A	10: 128,816,874		probably null	Het
Dner	A	G	1: 84,695,472	V86A	probably benign	Het
Dspp	A	T	5: 104,174,894		probably null	Het
Gphn	T	C	12: 78,627,262		probably null	Het
Gpr158	A	G	2: 21,368,231		probably benign	Het
Grip1	G	T	10: 119,945,056	L203F	probably damaging	Het
Hgfac	T	C	5: 35,044,789	W345R	probably damaging	Het
Hoga1	T	C	19: 42,063,258	L250P	probably damaging	Het
Ighv1-24	T	C	12: 114,773,043	Y79C	possibly damaging	Het
Kif21a	C	T	15: 90,969,827	R779Q	probably damaging	Het
Klkb1	T	C	8: 45,289,030	T71A	probably benign	Het
Lama2	A	G	10: 27,422,689	V137A	probably damaging	Het
Lrp2	T	C	2: 69,503,547	D1450G	probably benign	Het
Lrrc8c	T	A	5: 105,608,490	Y710*	probably null	Het
Mixl1	A	G	1: 180,694,693	S208P	probably benign	Het
Mroh1	A	G	15: 76,408,015	H229R	probably benign	Het
Muc16	T	A	9: 18,646,171	Q2942L	unknown	Het
Nicn1	C	T	9: 108,294,509	R163C	possibly damaging	Het
Nos1	G	C	5: 117,879,337	R255P	probably benign	Het
Nup85	T	C	11: 115,578,598	I322T	probably benign	Het
Olfr1138	T	A	2: 87,738,028	M99L	probably benign	Het
Olfr826	A	G	10: 130,180,736	M48T	possibly damaging	Het
Olfr860	T	A	9: 19,845,916	K234N	possibly damaging	Het
Olfr878	C	T	9: 37,919,151	L165F	probably damaging	Het
Olfr964-ps1	A	G	9: 39,686,818	L42P	probably damaging	Het
Pcyt1a	G	A	16: 32,470,076	R245Q	probably benign	Het
Pi15	T	C	1: 17,624,956	Y266H	probably benign	Het
Plxna2	C	T	1: 194,810,166	T1777I	probably damaging	Het
Ppp3cb	T	C	14: 20,531,806	D47G	probably benign	Het
Pram1	T	C	17: 33,641,467	V336A	probably damaging	Het
Prl	T	A	13: 27,059,520	I58N	probably damaging	Het
Qrich2	T	C	11: 116,458,108	D630G	unknown	Het
Ralgapa1	G	C	12: 55,722,798	P803A	probably damaging	Het
Rin1	A	G	19: 5,053,221	K513E	probably damaging	Het
Rtcb	A	T	10: 85,943,207		probably null	Het
Ryr2	C	T	13: 11,883,116	C131Y	probably damaging	Het
Sspo	G	T	6: 48,487,994	V3954L	probably damaging	Het
Taf4b	C	T	18: 14,813,374	T418M	probably damaging	Het
Taf6	A	G	5: 138,183,690	I92T	possibly damaging	Het
Tfg	A	T	16: 56,705,687	D64E	probably damaging	Het
Tkfc	T	A	19: 10,597,348	E176V	probably damaging	Het
Tmco1	C	T	1: 167,308,563		probably benign	Het
Tmem200a	A	T	10: 25,993,756	L205Q	probably damaging	Het
Trav13n-3	T	G	14: 53,337,396	L32V	probably damaging	Het
Tsen2	T	A	6: 115,576,903	M414K	probably damaging	Het
Txlna	A	T	4: 129,637,107	Y196N	probably damaging	Het
Usp44	T	A	10: 93,852,773	I562K	possibly damaging	Het
Vmn1r24	T	A	6: 57,955,751	I261F	probably benign	Het
Vmn2r106	T	C	17: 20,275,804	T553A	probably damaging	Het
Vmn2r65	A	G	7: 84,947,442	V135A	probably damaging	Het
Zcchc6	T	C	13: 59,788,474	Y1271C	possibly damaging	Het

Other mutations in Abtb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01161:Abtb2	APN	2	103705118	missense	probably benign	0.00
IGL02605:Abtb2	APN	2	103717257	missense	probably benign
IGL03161:Abtb2	APN	2	103567454	missense	probably benign	0.02
PIT4504001:Abtb2	UTSW	2	103717192	nonsense	probably null
R0147:Abtb2	UTSW	2	103567135	missense	probably benign	0.04
R1052:Abtb2	UTSW	2	103705072	missense	possibly damaging	0.46
R1419:Abtb2	UTSW	2	103709420	missense	probably benign	0.00
R1518:Abtb2	UTSW	2	103709284	missense	probably benign	0.03
R1650:Abtb2	UTSW	2	103702402	missense	probably damaging	1.00
R1795:Abtb2	UTSW	2	103567024	missense	probably benign	0.00
R2054:Abtb2	UTSW	2	103705117	missense	probably benign	0.41
R2101:Abtb2	UTSW	2	103566862	missense	probably benign	0.05
R2363:Abtb2	UTSW	2	103567183	missense	probably damaging	1.00
R3440:Abtb2	UTSW	2	103567232	missense	probably benign	0.43
R3927:Abtb2	UTSW	2	103708218	splice site	probably null
R4351:Abtb2	UTSW	2	103683393	missense	possibly damaging	0.46
R4352:Abtb2	UTSW	2	103683393	missense	possibly damaging	0.46
R4782:Abtb2	UTSW	2	103717299	missense	probably benign	0.35
R4814:Abtb2	UTSW	2	103717287	missense	probably benign	0.08
R4831:Abtb2	UTSW	2	103683475	missense	probably benign	0.06
R4900:Abtb2	UTSW	2	103567004	missense	possibly damaging	0.62
R5038:Abtb2	UTSW	2	103567063	missense	probably damaging	0.99
R5513:Abtb2	UTSW	2	103709278	critical splice acceptor site	probably null
R6119:Abtb2	UTSW	2	103702310	missense	probably benign	0.00
R6298:Abtb2	UTSW	2	103709488	missense	probably benign	0.10
R6383:Abtb2	UTSW	2	103567376	missense	probably damaging	0.98
R6860:Abtb2	UTSW	2	103709425	nonsense	probably null
R7000:Abtb2	UTSW	2	103712442	missense	possibly damaging	0.85
R7109:Abtb2	UTSW	2	103715515	missense	probably benign	0.20
R7176:Abtb2	UTSW	2	103709375	missense	probably benign	0.00
R7189:Abtb2	UTSW	2	103567516	missense	probably benign	0.00
R7199:Abtb2	UTSW	2	103567220	missense	possibly damaging	0.74
R7299:Abtb2	UTSW	2	103702424	splice site	probably null
R7347:Abtb2	UTSW	2	103567412	missense	probably damaging	1.00
R7469:Abtb2	UTSW	2	103566947	missense	probably benign	0.00
R7629:Abtb2	UTSW	2	103683493	critical splice donor site	probably null
R7862:Abtb2	UTSW	2	103702281	missense	probably damaging	1.00
R8200:Abtb2	UTSW	2	103700817	missense	probably benign	0.02
R8682:Abtb2	UTSW	2	103567375	missense	probably benign	0.36
R8700:Abtb2	UTSW	2	103566944	missense	probably damaging	0.99
R9164:Abtb2	UTSW	2	103711484	missense	possibly damaging	0.50
R9196:Abtb2	UTSW	2	103683302	missense	possibly damaging	0.71
R9258:Abtb2	UTSW	2	103716065	missense	probably null	0.99
R9343:Abtb2	UTSW	2	103717160	missense	probably benign
R9427:Abtb2	UTSW	2	103700899	missense	probably damaging	1.00
R9675:Abtb2	UTSW	2	103708187	missense	probably benign
Z1176:Abtb2	UTSW	2	103708172	nonsense	probably null
Z1177:Abtb2	UTSW	2	103711196	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCTGTTCTGGCCAACAAGC -3'
(R):5'- TTCAGAAAGTGAGGATCTGTGG -3'

Sequencing Primer
(F):5'- ACAAGCCTGATGTAGCTGC -3'
(R):5'- CAAGATAGTGTCAGGGTATCAACC -3'

Posted On

2022-03-25