Incidental Mutation 'R9254:Atxn2'
ID 701717
Institutional Source Beutler Lab
Gene Symbol Atxn2
Ensembl Gene ENSMUSG00000042605
Gene Name ataxin 2
Synonyms 9630045M23Rik, ATX2, Sca2
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.820) question?
Stock # R9254 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 121849672-121954372 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 121885509 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 239 (V239I)
Ref Sequence ENSEMBL: ENSMUSP00000056715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051950] [ENSMUST00000161064] [ENSMUST00000225761]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000051950
AA Change: V239I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056715
Gene: ENSMUSG00000042605
AA Change: V239I

DomainStartEndE-ValueType
low complexity region 32 42 N/A INTRINSIC
low complexity region 46 69 N/A INTRINSIC
low complexity region 93 116 N/A INTRINSIC
low complexity region 128 144 N/A INTRINSIC
low complexity region 168 219 N/A INTRINSIC
Pfam:SM-ATX 236 307 6.4e-23 PFAM
LsmAD 378 446 8.57e-25 SMART
low complexity region 520 540 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
low complexity region 685 705 N/A INTRINSIC
low complexity region 807 838 N/A INTRINSIC
low complexity region 864 879 N/A INTRINSIC
Pfam:PAM2 880 897 5.7e-9 PFAM
low complexity region 1128 1165 N/A INTRINSIC
low complexity region 1185 1196 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161064
SMART Domains Protein: ENSMUSP00000124070
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
LsmAD 69 137 8.57e-25 SMART
low complexity region 211 231 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
low complexity region 376 396 N/A INTRINSIC
low complexity region 498 529 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Pfam:PAM2 571 588 3.5e-9 PFAM
low complexity region 801 838 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
low complexity region 915 923 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000225761
AA Change: V89I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of genes that is associated with microsatellite-expansion diseases, a class of neurological and neuromuscular disorders caused by expansion of short stretches of repetitive DNA. The protein encoded by this gene has two globular domains near the N-terminus, one of which contains a clathrin-mediated trans-Golgi signal and an endoplasmic reticulum exit signal. The encoded cytoplasmic protein localizes to the endoplasmic reticulum and plasma membrane, is involved in endocytosis, and modulates mTOR signals, modifying ribosomal translation and mitochondrial function. The N-terminal region of the protein contains a polyglutamine tract of 14-31 residues that can be expanded in the pathogenic state to 32-200 residues. Intermediate length expansions of this tract increase susceptibility to amyotrophic lateral sclerosis, while long expansions of this tract result in spinocerebellar ataxia-2, an autosomal-dominantly inherited, neurodegenerative disorder. Genome-wide association studies indicate that loss-of-function mutations in this gene may be associated with susceptibility to type I diabetes, obesity and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mice exhibit an enlarged fat pad, hepatic steatosis and enlarged seminal vesicles. A mild defect in motor learning is seen, but no other notable behavioral or neurological defects are detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 A G 6: 86,914,049 (GRCm39) I173V possibly damaging Het
Abca14 G T 7: 119,807,202 (GRCm39) E83* probably null Het
Abcc5 T C 16: 20,152,437 (GRCm39) T1370A probably damaging Het
Abtb2 A G 2: 103,541,580 (GRCm39) T828A probably benign Het
Agap1 T A 1: 89,653,741 (GRCm39) V370D probably damaging Het
Ankhd1 T C 18: 36,777,680 (GRCm39) V1621A probably benign Het
Atp2a2 T C 5: 122,611,315 (GRCm39) I168V probably benign Het
B230219D22Rik C A 13: 55,847,283 (GRCm39) A132E probably damaging Het
Bod1l T C 5: 41,979,223 (GRCm39) E697G probably damaging Het
Ccdc162 T G 10: 41,488,944 (GRCm39) probably null Het
Chd7 A G 4: 8,752,210 (GRCm39) S236G unknown Het
Csmd2 A G 4: 128,091,112 (GRCm39) E217G Het
Cyp2j7 T A 4: 96,105,740 (GRCm39) K257* probably null Het
D630003M21Rik C T 2: 158,042,883 (GRCm39) A886T probably damaging Het
D630044L22Rik A G 17: 26,180,856 (GRCm39) H102R possibly damaging Het
Dact3 G A 7: 16,620,013 (GRCm39) V503I unknown Het
Dcn G T 10: 97,343,643 (GRCm39) R201L probably damaging Het
Dmxl1 T C 18: 50,024,567 (GRCm39) V1747A possibly damaging Het
Dnajc14 T A 10: 128,652,743 (GRCm39) probably null Het
Dner A G 1: 84,673,193 (GRCm39) V86A probably benign Het
Dspp A T 5: 104,322,760 (GRCm39) probably null Het
Gphn T C 12: 78,674,036 (GRCm39) probably null Het
Gpr158 A G 2: 21,373,042 (GRCm39) probably benign Het
Grip1 G T 10: 119,780,961 (GRCm39) L203F probably damaging Het
Hgfac T C 5: 35,202,133 (GRCm39) W345R probably damaging Het
Hoga1 T C 19: 42,051,697 (GRCm39) L250P probably damaging Het
Ighv1-24 T C 12: 114,736,663 (GRCm39) Y79C possibly damaging Het
Katnip T C 7: 125,469,848 (GRCm39) L1439P probably damaging Het
Kif21a C T 15: 90,854,030 (GRCm39) R779Q probably damaging Het
Klkb1 T C 8: 45,742,067 (GRCm39) T71A probably benign Het
Lama2 A G 10: 27,298,685 (GRCm39) V137A probably damaging Het
Lrp2 T C 2: 69,333,891 (GRCm39) D1450G probably benign Het
Lrrc8c T A 5: 105,756,356 (GRCm39) Y710* probably null Het
Mixl1 A G 1: 180,522,258 (GRCm39) S208P probably benign Het
Mroh1 A G 15: 76,292,215 (GRCm39) H229R probably benign Het
Muc16 T A 9: 18,557,467 (GRCm39) Q2942L unknown Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nos1 G C 5: 118,017,402 (GRCm39) R255P probably benign Het
Nup85 T C 11: 115,469,424 (GRCm39) I322T probably benign Het
Odad1 A G 7: 45,597,116 (GRCm39) T456A probably benign Het
Odad2 T C 18: 7,265,089 (GRCm39) D426G possibly damaging Het
Or10n7-ps1 A G 9: 39,598,114 (GRCm39) L42P probably damaging Het
Or5w15 T A 2: 87,568,372 (GRCm39) M99L probably benign Het
Or7e169 T A 9: 19,757,212 (GRCm39) K234N possibly damaging Het
Or8b4 C T 9: 37,830,447 (GRCm39) L165F probably damaging Het
Or9k2b A G 10: 130,016,605 (GRCm39) M48T possibly damaging Het
Pcyt1a G A 16: 32,288,894 (GRCm39) R245Q probably benign Het
Pi15 T C 1: 17,695,180 (GRCm39) Y266H probably benign Het
Plxna2 C T 1: 194,492,474 (GRCm39) T1777I probably damaging Het
Ppp3cb T C 14: 20,581,874 (GRCm39) D47G probably benign Het
Pram1 T C 17: 33,860,441 (GRCm39) V336A probably damaging Het
Prl T A 13: 27,243,503 (GRCm39) I58N probably damaging Het
Qrich2 T C 11: 116,348,934 (GRCm39) D630G unknown Het
Ralgapa1 G C 12: 55,769,583 (GRCm39) P803A probably damaging Het
Rin1 A G 19: 5,103,249 (GRCm39) K513E probably damaging Het
Rtcb A T 10: 85,779,071 (GRCm39) probably null Het
Ryr2 C T 13: 11,898,002 (GRCm39) C131Y probably damaging Het
Sspo G T 6: 48,464,928 (GRCm39) V3954L probably damaging Het
Taf4b C T 18: 14,946,431 (GRCm39) T418M probably damaging Het
Taf6 A G 5: 138,181,952 (GRCm39) I92T possibly damaging Het
Tfg A T 16: 56,526,050 (GRCm39) D64E probably damaging Het
Tkfc T A 19: 10,574,712 (GRCm39) E176V probably damaging Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tmem200a A T 10: 25,869,654 (GRCm39) L205Q probably damaging Het
Trav13n-3 T G 14: 53,574,853 (GRCm39) L32V probably damaging Het
Tsen2 T A 6: 115,553,864 (GRCm39) M414K probably damaging Het
Tut7 T C 13: 59,936,288 (GRCm39) Y1271C possibly damaging Het
Txlna A T 4: 129,530,900 (GRCm39) Y196N probably damaging Het
Usp44 T A 10: 93,688,635 (GRCm39) I562K possibly damaging Het
Vmn1r24 T A 6: 57,932,736 (GRCm39) I261F probably benign Het
Vmn2r106 T C 17: 20,496,066 (GRCm39) T553A probably damaging Het
Vmn2r65 A G 7: 84,596,650 (GRCm39) V135A probably damaging Het
Other mutations in Atxn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Atxn2 APN 5 121,933,118 (GRCm39) missense probably benign 0.00
IGL00798:Atxn2 APN 5 121,933,298 (GRCm39) missense possibly damaging 0.58
IGL01518:Atxn2 APN 5 121,949,042 (GRCm39) missense probably damaging 1.00
IGL01737:Atxn2 APN 5 121,935,407 (GRCm39) missense probably damaging 0.98
IGL01832:Atxn2 APN 5 121,944,331 (GRCm39) nonsense probably null
IGL02122:Atxn2 APN 5 121,916,093 (GRCm39) missense probably damaging 1.00
IGL02333:Atxn2 APN 5 121,919,450 (GRCm39) missense probably damaging 1.00
IGL02742:Atxn2 APN 5 121,919,399 (GRCm39) missense possibly damaging 0.75
IGL03028:Atxn2 APN 5 121,948,972 (GRCm39) missense probably damaging 1.00
IGL03282:Atxn2 APN 5 121,923,298 (GRCm39) missense probably benign 0.00
R0387:Atxn2 UTSW 5 121,940,206 (GRCm39) missense possibly damaging 0.83
R0653:Atxn2 UTSW 5 121,910,841 (GRCm39) missense probably damaging 0.99
R0849:Atxn2 UTSW 5 121,885,484 (GRCm39) splice site probably null
R1305:Atxn2 UTSW 5 121,887,247 (GRCm39) missense probably damaging 1.00
R1440:Atxn2 UTSW 5 121,941,145 (GRCm39) critical splice donor site probably null
R1471:Atxn2 UTSW 5 121,924,437 (GRCm39) missense probably damaging 1.00
R1521:Atxn2 UTSW 5 121,917,654 (GRCm39) missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121,951,593 (GRCm39) missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121,940,171 (GRCm39) missense probably damaging 0.99
R2083:Atxn2 UTSW 5 121,922,069 (GRCm39) missense probably benign 0.00
R2197:Atxn2 UTSW 5 121,944,280 (GRCm39) splice site probably null
R2217:Atxn2 UTSW 5 121,941,140 (GRCm39) missense probably damaging 1.00
R2218:Atxn2 UTSW 5 121,941,140 (GRCm39) missense probably damaging 1.00
R2420:Atxn2 UTSW 5 121,940,142 (GRCm39) critical splice acceptor site probably null
R2421:Atxn2 UTSW 5 121,940,142 (GRCm39) critical splice acceptor site probably null
R2510:Atxn2 UTSW 5 121,919,456 (GRCm39) missense probably damaging 1.00
R3706:Atxn2 UTSW 5 121,923,931 (GRCm39) critical splice donor site probably null
R4604:Atxn2 UTSW 5 121,919,406 (GRCm39) missense probably damaging 1.00
R4852:Atxn2 UTSW 5 121,952,474 (GRCm39) missense probably damaging 0.97
R4914:Atxn2 UTSW 5 121,887,159 (GRCm39) missense probably damaging 1.00
R4982:Atxn2 UTSW 5 121,952,406 (GRCm39) missense possibly damaging 0.66
R5172:Atxn2 UTSW 5 121,933,098 (GRCm39) splice site probably null
R5213:Atxn2 UTSW 5 121,952,543 (GRCm39) splice site probably null
R5655:Atxn2 UTSW 5 121,885,489 (GRCm39) missense probably damaging 0.97
R5775:Atxn2 UTSW 5 121,951,512 (GRCm39) missense probably damaging 1.00
R5782:Atxn2 UTSW 5 121,935,373 (GRCm39) missense probably damaging 1.00
R6015:Atxn2 UTSW 5 121,949,055 (GRCm39) missense probably damaging 1.00
R6438:Atxn2 UTSW 5 121,917,495 (GRCm39) missense probably damaging 1.00
R6529:Atxn2 UTSW 5 121,949,677 (GRCm39) critical splice donor site probably null
R6659:Atxn2 UTSW 5 121,916,027 (GRCm39) missense probably benign 0.10
R6864:Atxn2 UTSW 5 121,917,557 (GRCm39) missense probably damaging 1.00
R7035:Atxn2 UTSW 5 121,949,530 (GRCm39) nonsense probably null
R7166:Atxn2 UTSW 5 121,934,460 (GRCm39) missense possibly damaging 0.90
R7253:Atxn2 UTSW 5 121,916,084 (GRCm39) missense probably damaging 1.00
R7257:Atxn2 UTSW 5 121,923,880 (GRCm39) missense possibly damaging 0.62
R7467:Atxn2 UTSW 5 121,940,330 (GRCm39) critical splice donor site probably null
R7544:Atxn2 UTSW 5 121,919,431 (GRCm39) missense probably damaging 1.00
R7648:Atxn2 UTSW 5 121,934,440 (GRCm39) missense probably damaging 0.99
R7883:Atxn2 UTSW 5 121,940,180 (GRCm39) missense possibly damaging 0.79
R8097:Atxn2 UTSW 5 121,887,286 (GRCm39) missense probably damaging 1.00
R8784:Atxn2 UTSW 5 121,933,091 (GRCm39) missense probably benign 0.00
R8835:Atxn2 UTSW 5 121,940,248 (GRCm39) missense possibly damaging 0.63
R8880:Atxn2 UTSW 5 121,948,973 (GRCm39) missense probably benign 0.24
R8983:Atxn2 UTSW 5 121,916,063 (GRCm39) missense probably damaging 1.00
R9332:Atxn2 UTSW 5 121,923,425 (GRCm39) missense probably damaging 1.00
R9379:Atxn2 UTSW 5 121,885,509 (GRCm39) missense probably damaging 1.00
R9412:Atxn2 UTSW 5 121,940,201 (GRCm39) missense possibly damaging 0.84
R9649:Atxn2 UTSW 5 121,949,055 (GRCm39) missense probably damaging 0.98
R9656:Atxn2 UTSW 5 121,922,061 (GRCm39) missense possibly damaging 0.78
X0028:Atxn2 UTSW 5 121,940,146 (GRCm39) missense probably benign 0.01
Z1176:Atxn2 UTSW 5 121,916,053 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCTACCTTTTCTCGTAGGGAAAC -3'
(R):5'- AAGCTACACACTTCTGTCCC -3'

Sequencing Primer
(F):5'- CCTTTTCTCGTAGGGAAACAAAATG -3'
(R):5'- TCTGTCCCCACTACCATTAGATAAC -3'
Posted On 2022-03-25