Mutagenetix > Incidental Mutation

Incidental Mutation 'R9255:Agbl3'

701797

Institutional Source

Beutler Lab

Gene Symbol

Agbl3

Ensembl Gene

ENSMUSG00000038836

Gene Name

ATP/GTP binding protein-like 3

Synonyms

4930431N21Rik, 2900053G10Rik, 6530406M24Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9255 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

34780432-34859459 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 34812905 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 531 (M531K)

Ref Sequence

ENSEMBL: ENSMUSP00000110668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000148834]

AlphaFold

Q8CDP0

Predicted Effect

probably damaging
Transcript: ENSMUST00000115016
AA Change: M531K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: M531K

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115017
AA Change: M526K

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: M526K

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148834

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	T	C	3: 108,469,548	R453G	probably damaging	Het
A2m	A	G	6: 121,649,836	Y549C	probably damaging	Het
Abca13	A	C	11: 9,328,213	N3131T	probably damaging	Het
Acap3	T	C	4: 155,905,688	V775A	probably benign	Het
Actn3	T	A	19: 4,871,792	I149F	probably damaging	Het
Adcy2	A	T	13: 68,888,080	M154K	possibly damaging	Het
Agbl1	A	T	7: 76,766,402	M976L	unknown	Het
Armc8	A	C	9: 99,497,388	M495R	possibly damaging	Het
Astn2	T	A	4: 65,644,848	K899*	probably null	Het
Atp10b	T	A	11: 43,216,321	H727Q	probably damaging	Het
Bach1	A	G	16: 87,722,513	I564V	possibly damaging	Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Ccdc136	T	A	6: 29,409,238	H183Q	probably benign	Het
Celf3	T	C	3: 94,485,287	F98L	probably benign	Het
Chrd	G	A	16: 20,740,051	C845Y	probably damaging	Het
Clec1a	T	G	6: 129,432,245	K139N	probably benign	Het
Cntln	T	G	4: 85,100,866	N130K	possibly damaging	Het
Cog1	A	T	11: 113,656,193	T538S	probably benign	Het
Cog8	A	G	8: 107,052,751	I298T	probably damaging	Het
Dio1	A	T	4: 107,306,905	W72R	probably damaging	Het
Exph5	T	A	9: 53,373,309	N563K	possibly damaging	Het
Foxn1	C	A	11: 78,361,573	E330*	probably null	Het
Fzd7	G	T	1: 59,483,336	R126L	possibly damaging	Het
Gm9268	A	T	7: 43,024,541	Y348F	possibly damaging	Het
Gmnn	A	G	13: 24,753,368	Y147H	probably benign	Het
Gpa33	A	G	1: 166,152,617	N83S	probably benign	Het
Hdac4	A	G	1: 91,961,451		probably null	Het
Hydin	A	G	8: 110,535,340	D2691G	probably benign	Het
Ifi203	A	T	1: 173,929,221	I332N	unknown	Het
Inpp1	A	G	1: 52,790,147	S238P	probably benign	Het
Jmy	A	G	13: 93,453,386		probably null	Het
Kcnab3	C	T	11: 69,331,511	Q327*	probably null	Het
Kctd1	A	G	18: 15,061,796	V590A	probably benign	Het
Lrrc8e	A	T	8: 4,234,504	H243L	probably damaging	Het
Lsr	A	G	7: 30,958,245	L498S	probably benign	Het
Mapkbp1	A	G	2: 120,013,075	D268G	probably damaging	Het
Mfn1	T	C	3: 32,544,138	V203A	possibly damaging	Het
Micu1	T	A	10: 59,768,229	I212N	probably damaging	Het
Nicn1	C	T	9: 108,294,509	R163C	possibly damaging	Het
Nos1	G	C	5: 117,879,337	R255P	probably benign	Het
Olfr266	A	G	3: 106,822,421	I46T	probably benign	Het
Olfr533	T	C	7: 140,466,510	F103S	probably damaging	Het
Olfr948	T	C	9: 39,319,191	Y141C	probably benign	Het
Pabpc6	T	C	17: 9,667,840	E594G	probably damaging	Het
Pald1	A	T	10: 61,341,210		probably null	Het
Pdpk1	A	G	17: 24,106,964	I113T	possibly damaging	Het
Perm1	TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT	TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT	4: 156,218,068		probably benign	Het
Pi4kb	T	C	3: 94,998,908	S589P	probably damaging	Het
Pik3ca	G	A	3: 32,442,832		probably null	Het
Plekhg4	A	T	8: 105,376,639	M315L	probably benign	Het
Proz	G	A	8: 13,073,472	V248M	possibly damaging	Het
Prss1	T	C	6: 41,461,249	Y37H	probably damaging	Het
R3hdml	T	A	2: 163,495,692	W89R	probably damaging	Het
Ranbp3l	A	G	15: 9,057,212	T319A	probably benign	Het
Scn4a	C	T	11: 106,324,228	A1246T	probably damaging	Het
Sdr42e1	T	A	8: 117,663,260	Y214F	probably benign	Het
Slc10a2	C	T	8: 5,098,565	V127I	probably benign	Het
Slc16a1	T	A	3: 104,652,832	M151K	possibly damaging	Het
Slc25a25	C	T	2: 32,420,379	E123K	probably damaging	Het
Ssbp2	T	A	13: 91,670,406	M171K	possibly damaging	Het
Styk1	A	G	6: 131,309,983	V183A	probably damaging	Het
Tmco1	C	T	1: 167,308,563		probably benign	Het
Tspan18	T	G	2: 93,209,855	D185A	probably benign	Het
Tti2	T	A	8: 31,155,542	F320Y	probably damaging	Het
Ttn	T	C	2: 76,778,277	I17798M	probably damaging	Het
Ube2j1	C	A	4: 33,036,759	H28N	probably benign	Het
Vmn1r195	A	C	13: 22,279,172	I271L	possibly damaging	Het
Vmn2r81	A	C	10: 79,267,332	T120P	possibly damaging	Het
Wtip	A	G	7: 34,125,483		probably null	Het
Zc3h12d	C	T	10: 7,853,258	H129Y	probably damaging	Het
Zfp600	T	G	4: 146,195,103	S114A	possibly damaging	Het

Other mutations in Agbl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Agbl3	APN	6	34846836	missense	probably damaging	1.00
IGL00835:Agbl3	APN	6	34799732	missense	probably damaging	1.00
IGL00840:Agbl3	APN	6	34799159	missense	possibly damaging	0.95
IGL01090:Agbl3	APN	6	34799887	missense	probably benign	0.40
IGL01123:Agbl3	APN	6	34846976	nonsense	probably null
IGL01707:Agbl3	APN	6	34839454	missense	possibly damaging	0.78
IGL01728:Agbl3	APN	6	34782157	start codon destroyed	probably null
IGL02335:Agbl3	APN	6	34799750	missense	probably damaging	1.00
IGL02420:Agbl3	APN	6	34785307	missense	possibly damaging	0.47
IGL02551:Agbl3	APN	6	34823071	missense	possibly damaging	0.88
IGL02974:Agbl3	APN	6	34799822	missense	probably damaging	1.00
IGL03167:Agbl3	APN	6	34857659	missense	possibly damaging	0.92
IGL03182:Agbl3	APN	6	34803500	missense	probably damaging	1.00
R0044:Agbl3	UTSW	6	34799899	missense	probably damaging	1.00
R0499:Agbl3	UTSW	6	34839335	missense	probably benign
R0639:Agbl3	UTSW	6	34799705	missense	probably damaging	1.00
R0850:Agbl3	UTSW	6	34799204	missense	probably damaging	1.00
R1004:Agbl3	UTSW	6	34803451	missense	probably damaging	0.99
R1080:Agbl3	UTSW	6	34828235	missense	probably benign	0.14
R1589:Agbl3	UTSW	6	34857517	missense	possibly damaging	0.77
R2361:Agbl3	UTSW	6	34832505	missense	possibly damaging	0.87
R2495:Agbl3	UTSW	6	34846764	missense	probably damaging	1.00
R3236:Agbl3	UTSW	6	34823087	splice site	probably null
R3237:Agbl3	UTSW	6	34823087	splice site	probably null
R3420:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3421:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3422:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3810:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R3811:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R4059:Agbl3	UTSW	6	34846899	missense	probably damaging	1.00
R4499:Agbl3	UTSW	6	34857598	missense	probably benign	0.00
R4687:Agbl3	UTSW	6	34798326	missense	probably damaging	1.00
R4854:Agbl3	UTSW	6	34785284	missense	probably damaging	0.97
R5354:Agbl3	UTSW	6	34814752	missense	probably benign	0.03
R5386:Agbl3	UTSW	6	34799196	missense	probably damaging	1.00
R5897:Agbl3	UTSW	6	34803573	missense	probably benign	0.21
R6018:Agbl3	UTSW	6	34799255	missense	probably damaging	1.00
R6148:Agbl3	UTSW	6	34857753	missense	possibly damaging	0.87
R6305:Agbl3	UTSW	6	34782210	missense	unknown
R6525:Agbl3	UTSW	6	34803594	nonsense	probably null
R6546:Agbl3	UTSW	6	34799299	missense	probably damaging	1.00
R6743:Agbl3	UTSW	6	34846953	missense	probably benign	0.03
R6986:Agbl3	UTSW	6	34839452	missense	probably benign	0.42
R7023:Agbl3	UTSW	6	34814769	missense	probably benign	0.02
R7411:Agbl3	UTSW	6	34814819	missense	probably damaging	0.99
R7469:Agbl3	UTSW	6	34814414	missense	probably damaging	1.00
R7631:Agbl3	UTSW	6	34857671	missense	possibly damaging	0.95
R7658:Agbl3	UTSW	6	34832508	missense	probably benign	0.11
R7743:Agbl3	UTSW	6	34846830	missense	probably damaging	1.00
R7801:Agbl3	UTSW	6	34839365	missense	probably benign	0.00
R8033:Agbl3	UTSW	6	34839494	missense	possibly damaging	0.95
R8203:Agbl3	UTSW	6	34799479	missense	probably damaging	1.00
R8769:Agbl3	UTSW	6	34857614	missense	probably damaging	0.96
R9072:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9073:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9210:Agbl3	UTSW	6	34798242	missense	probably damaging	0.98
R9536:Agbl3	UTSW	6	34846926	missense	probably benign
R9560:Agbl3	UTSW	6	34846908	missense	possibly damaging	0.94
R9662:Agbl3	UTSW	6	34832533	nonsense	probably null
RF014:Agbl3	UTSW	6	34799358	missense	possibly damaging	0.53
Z1177:Agbl3	UTSW	6	34799408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAGCTGACCCTGGTATTTGC -3'
(R):5'- GAGATACCCCACAAGAGAAGTTTATTC -3'

Sequencing Primer
(F):5'- ACCCTGGTATTTGCGAGTAAC -3'
(R):5'- CCACAAGAGAAGTTTATTCATCTTGC -3'

Posted On

2022-03-25