Incidental Mutation 'R9255:Agbl3'
ID 701797
Institutional Source Beutler Lab
Gene Symbol Agbl3
Ensembl Gene ENSMUSG00000038836
Gene Name ATP/GTP binding protein-like 3
Synonyms 4930431N21Rik, 2900053G10Rik, 6530406M24Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9255 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 34780432-34859459 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34812905 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 531 (M531K)
Ref Sequence ENSEMBL: ENSMUSP00000110668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000148834]
AlphaFold Q8CDP0
Predicted Effect probably damaging
Transcript: ENSMUST00000115016
AA Change: M531K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: M531K

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 314 563 2.7e-19 PFAM
low complexity region 614 629 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115017
AA Change: M526K

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: M526K

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 309 560 1e-33 PFAM
low complexity region 609 624 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148834
SMART Domains Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T C 3: 108,469,548 R453G probably damaging Het
A2m A G 6: 121,649,836 Y549C probably damaging Het
Abca13 A C 11: 9,328,213 N3131T probably damaging Het
Acap3 T C 4: 155,905,688 V775A probably benign Het
Actn3 T A 19: 4,871,792 I149F probably damaging Het
Adcy2 A T 13: 68,888,080 M154K possibly damaging Het
Agbl1 A T 7: 76,766,402 M976L unknown Het
Armc8 A C 9: 99,497,388 M495R possibly damaging Het
Astn2 T A 4: 65,644,848 K899* probably null Het
Atp10b T A 11: 43,216,321 H727Q probably damaging Het
Bach1 A G 16: 87,722,513 I564V possibly damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Ccdc136 T A 6: 29,409,238 H183Q probably benign Het
Celf3 T C 3: 94,485,287 F98L probably benign Het
Chrd G A 16: 20,740,051 C845Y probably damaging Het
Clec1a T G 6: 129,432,245 K139N probably benign Het
Cntln T G 4: 85,100,866 N130K possibly damaging Het
Cog1 A T 11: 113,656,193 T538S probably benign Het
Cog8 A G 8: 107,052,751 I298T probably damaging Het
Dio1 A T 4: 107,306,905 W72R probably damaging Het
Exph5 T A 9: 53,373,309 N563K possibly damaging Het
Foxn1 C A 11: 78,361,573 E330* probably null Het
Fzd7 G T 1: 59,483,336 R126L possibly damaging Het
Gm9268 A T 7: 43,024,541 Y348F possibly damaging Het
Gmnn A G 13: 24,753,368 Y147H probably benign Het
Gpa33 A G 1: 166,152,617 N83S probably benign Het
Hdac4 A G 1: 91,961,451 probably null Het
Hydin A G 8: 110,535,340 D2691G probably benign Het
Ifi203 A T 1: 173,929,221 I332N unknown Het
Inpp1 A G 1: 52,790,147 S238P probably benign Het
Jmy A G 13: 93,453,386 probably null Het
Kcnab3 C T 11: 69,331,511 Q327* probably null Het
Kctd1 A G 18: 15,061,796 V590A probably benign Het
Lrrc8e A T 8: 4,234,504 H243L probably damaging Het
Lsr A G 7: 30,958,245 L498S probably benign Het
Mapkbp1 A G 2: 120,013,075 D268G probably damaging Het
Mfn1 T C 3: 32,544,138 V203A possibly damaging Het
Micu1 T A 10: 59,768,229 I212N probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Olfr266 A G 3: 106,822,421 I46T probably benign Het
Olfr533 T C 7: 140,466,510 F103S probably damaging Het
Olfr948 T C 9: 39,319,191 Y141C probably benign Het
Pabpc6 T C 17: 9,667,840 E594G probably damaging Het
Pald1 A T 10: 61,341,210 probably null Het
Pdpk1 A G 17: 24,106,964 I113T possibly damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pi4kb T C 3: 94,998,908 S589P probably damaging Het
Pik3ca G A 3: 32,442,832 probably null Het
Plekhg4 A T 8: 105,376,639 M315L probably benign Het
Proz G A 8: 13,073,472 V248M possibly damaging Het
Prss1 T C 6: 41,461,249 Y37H probably damaging Het
R3hdml T A 2: 163,495,692 W89R probably damaging Het
Ranbp3l A G 15: 9,057,212 T319A probably benign Het
Scn4a C T 11: 106,324,228 A1246T probably damaging Het
Sdr42e1 T A 8: 117,663,260 Y214F probably benign Het
Slc10a2 C T 8: 5,098,565 V127I probably benign Het
Slc16a1 T A 3: 104,652,832 M151K possibly damaging Het
Slc25a25 C T 2: 32,420,379 E123K probably damaging Het
Ssbp2 T A 13: 91,670,406 M171K possibly damaging Het
Styk1 A G 6: 131,309,983 V183A probably damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tspan18 T G 2: 93,209,855 D185A probably benign Het
Tti2 T A 8: 31,155,542 F320Y probably damaging Het
Ttn T C 2: 76,778,277 I17798M probably damaging Het
Ube2j1 C A 4: 33,036,759 H28N probably benign Het
Vmn1r195 A C 13: 22,279,172 I271L possibly damaging Het
Vmn2r81 A C 10: 79,267,332 T120P possibly damaging Het
Wtip A G 7: 34,125,483 probably null Het
Zc3h12d C T 10: 7,853,258 H129Y probably damaging Het
Zfp600 T G 4: 146,195,103 S114A possibly damaging Het
Other mutations in Agbl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Agbl3 APN 6 34846836 missense probably damaging 1.00
IGL00835:Agbl3 APN 6 34799732 missense probably damaging 1.00
IGL00840:Agbl3 APN 6 34799159 missense possibly damaging 0.95
IGL01090:Agbl3 APN 6 34799887 missense probably benign 0.40
IGL01123:Agbl3 APN 6 34846976 nonsense probably null
IGL01707:Agbl3 APN 6 34839454 missense possibly damaging 0.78
IGL01728:Agbl3 APN 6 34782157 start codon destroyed probably null
IGL02335:Agbl3 APN 6 34799750 missense probably damaging 1.00
IGL02420:Agbl3 APN 6 34785307 missense possibly damaging 0.47
IGL02551:Agbl3 APN 6 34823071 missense possibly damaging 0.88
IGL02974:Agbl3 APN 6 34799822 missense probably damaging 1.00
IGL03167:Agbl3 APN 6 34857659 missense possibly damaging 0.92
IGL03182:Agbl3 APN 6 34803500 missense probably damaging 1.00
R0044:Agbl3 UTSW 6 34799899 missense probably damaging 1.00
R0499:Agbl3 UTSW 6 34839335 missense probably benign
R0639:Agbl3 UTSW 6 34799705 missense probably damaging 1.00
R0850:Agbl3 UTSW 6 34799204 missense probably damaging 1.00
R1004:Agbl3 UTSW 6 34803451 missense probably damaging 0.99
R1080:Agbl3 UTSW 6 34828235 missense probably benign 0.14
R1589:Agbl3 UTSW 6 34857517 missense possibly damaging 0.77
R2361:Agbl3 UTSW 6 34832505 missense possibly damaging 0.87
R2495:Agbl3 UTSW 6 34846764 missense probably damaging 1.00
R3236:Agbl3 UTSW 6 34823087 splice site probably null
R3237:Agbl3 UTSW 6 34823087 splice site probably null
R3420:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3421:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3422:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3810:Agbl3 UTSW 6 34799729 missense probably damaging 1.00
R3811:Agbl3 UTSW 6 34799729 missense probably damaging 1.00
R4059:Agbl3 UTSW 6 34846899 missense probably damaging 1.00
R4499:Agbl3 UTSW 6 34857598 missense probably benign 0.00
R4687:Agbl3 UTSW 6 34798326 missense probably damaging 1.00
R4854:Agbl3 UTSW 6 34785284 missense probably damaging 0.97
R5354:Agbl3 UTSW 6 34814752 missense probably benign 0.03
R5386:Agbl3 UTSW 6 34799196 missense probably damaging 1.00
R5897:Agbl3 UTSW 6 34803573 missense probably benign 0.21
R6018:Agbl3 UTSW 6 34799255 missense probably damaging 1.00
R6148:Agbl3 UTSW 6 34857753 missense possibly damaging 0.87
R6305:Agbl3 UTSW 6 34782210 missense unknown
R6525:Agbl3 UTSW 6 34803594 nonsense probably null
R6546:Agbl3 UTSW 6 34799299 missense probably damaging 1.00
R6743:Agbl3 UTSW 6 34846953 missense probably benign 0.03
R6986:Agbl3 UTSW 6 34839452 missense probably benign 0.42
R7023:Agbl3 UTSW 6 34814769 missense probably benign 0.02
R7411:Agbl3 UTSW 6 34814819 missense probably damaging 0.99
R7469:Agbl3 UTSW 6 34814414 missense probably damaging 1.00
R7631:Agbl3 UTSW 6 34857671 missense possibly damaging 0.95
R7658:Agbl3 UTSW 6 34832508 missense probably benign 0.11
R7743:Agbl3 UTSW 6 34846830 missense probably damaging 1.00
R7801:Agbl3 UTSW 6 34839365 missense probably benign 0.00
R8033:Agbl3 UTSW 6 34839494 missense possibly damaging 0.95
R8203:Agbl3 UTSW 6 34799479 missense probably damaging 1.00
R8769:Agbl3 UTSW 6 34857614 missense probably damaging 0.96
R9072:Agbl3 UTSW 6 34799452 missense probably damaging 1.00
R9073:Agbl3 UTSW 6 34799452 missense probably damaging 1.00
R9210:Agbl3 UTSW 6 34798242 missense probably damaging 0.98
RF014:Agbl3 UTSW 6 34799358 missense possibly damaging 0.53
Z1177:Agbl3 UTSW 6 34799408 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGCTGACCCTGGTATTTGC -3'
(R):5'- GAGATACCCCACAAGAGAAGTTTATTC -3'

Sequencing Primer
(F):5'- ACCCTGGTATTTGCGAGTAAC -3'
(R):5'- CCACAAGAGAAGTTTATTCATCTTGC -3'
Posted On 2022-03-25