Incidental Mutation 'R9256:Copg2'
ID 701863
Institutional Source Beutler Lab
Gene Symbol Copg2
Ensembl Gene ENSMUSG00000025607
Gene Name coatomer protein complex, subunit gamma 2
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock # R9256 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 30747554-30896794 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30811702 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 555 (I555M)
Ref Sequence ENSEMBL: ENSMUSP00000038368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048774] [ENSMUST00000166192]
AlphaFold Q9QXK3
Predicted Effect probably benign
Transcript: ENSMUST00000048774
AA Change: I555M

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000038368
Gene: ENSMUSG00000025607
AA Change: I555M

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 539 2.6e-134 PFAM
Pfam:COP-gamma_platf 609 756 7.7e-66 PFAM
Pfam:Coatomer_g_Cpla 758 870 1.6e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166192
AA Change: I555M

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000126726
Gene: ENSMUSG00000025607
AA Change: I555M

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 380 6.5e-92 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 A G 8: 46,492,893 Y21C probably damaging Het
Adamts7 A T 9: 90,178,165 I290F probably damaging Het
Adcy5 G A 16: 35,303,682 V1244I probably damaging Het
Adnp A T 2: 168,184,025 I450N probably damaging Het
AL732309.1 A T 2: 25,246,199 M1K probably null Het
Alox15 C T 11: 70,345,544 G510D possibly damaging Het
Arhgef16 C A 4: 154,279,045 E685* probably null Het
Atp13a2 A G 4: 141,002,727 E643G probably damaging Het
AW554918 C A 18: 25,290,004 Q171K probably damaging Het
Bdkrb2 A G 12: 105,592,093 T198A probably benign Het
C530008M17Rik T G 5: 76,840,910 V36G unknown Het
C7 T C 15: 4,994,163 E721G probably damaging Het
Cc2d2b T C 19: 40,809,404 Y823H unknown Het
Cd74 T C 18: 60,811,294 V192A probably benign Het
Cdc42bpg G A 19: 6,311,037 A231T probably damaging Het
Cers6 G A 2: 68,947,362 probably benign Het
Crnkl1 A G 2: 145,928,296 V209A possibly damaging Het
Dock7 T C 4: 99,083,035 T98A Het
Enpp5 T C 17: 44,085,523 I442T probably benign Het
Fbxw19 T C 9: 109,481,573 Y427C probably damaging Het
Fktn T C 4: 53,744,653 V311A probably benign Het
Fyb T G 15: 6,644,877 S665A possibly damaging Het
Igkv6-20 T C 6: 70,336,433 Y16C probably benign Het
Ints10 A G 8: 68,808,477 R370G possibly damaging Het
Iqub A T 6: 24,446,199 I742N possibly damaging Het
Kcnn3 T C 3: 89,667,100 Y640H probably damaging Het
Lrp2 A G 2: 69,510,959 V959A probably benign Het
Marcksl1 A G 4: 129,515,023 S132G probably benign Het
Mfsd4b3 T A 10: 39,948,014 K83N probably damaging Het
Mib1 A G 18: 10,760,862 E384G possibly damaging Het
Morn5 G T 2: 36,049,541 G5W probably damaging Het
Mrpl46 A G 7: 78,782,923 S36P probably benign Het
Mtif2 T C 11: 29,540,777 F494L probably benign Het
Naalad2 T C 9: 18,363,238 N336S probably benign Het
Nepro A G 16: 44,724,427 N22S probably benign Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Olfr248 C T 1: 174,391,543 T158I probably benign Het
Olfr397 A T 11: 73,965,309 I234F probably benign Het
Olfr716 T C 7: 107,148,180 I288T probably damaging Het
Olfr824 A G 10: 130,126,466 V197A possibly damaging Het
Olfr894 T A 9: 38,219,202 Y123* probably null Het
Pcnx A T 12: 81,973,273 N724Y Het
Pde8b G A 13: 95,027,696 R669C probably damaging Het
Pkhd1l1 T A 15: 44,533,894 probably null Het
Pls1 A G 9: 95,773,643 V352A probably damaging Het
Prpmp5 T C 6: 132,312,009 N284S unknown Het
Prtg A T 9: 72,851,695 I444F probably damaging Het
Ptprb A T 10: 116,383,871 H1998L probably damaging Het
Qrich2 A T 11: 116,465,624 V133D probably benign Het
Rab35 C A 5: 115,640,187 R71S probably damaging Het
Scgb2b12 A G 7: 32,326,629 L46P probably damaging Het
Sdha A T 13: 74,327,364 probably benign Het
Sdr39u1 C A 14: 55,897,752 V245F probably benign Het
Sgo2a T A 1: 58,019,613 V1117E possibly damaging Het
Slc12a2 T C 18: 57,941,795 S1154P probably damaging Het
Slc6a1 A T 6: 114,310,593 Q441L possibly damaging Het
Smtnl2 A T 11: 72,403,009 probably null Het
Sorbs2 T G 8: 45,795,737 V675G probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tmem38b A T 4: 53,848,924 I110F probably damaging Het
Ubqln1 A G 13: 58,177,907 I573T probably damaging Het
Usp9y T C Y: 1,356,235 I1155M possibly damaging Het
Vipr1 A G 9: 121,661,052 I164V probably benign Het
Vps13b T G 15: 35,623,779 S1281A possibly damaging Het
Vps13d A G 4: 145,155,804 L1073P Het
Wipi1 C T 11: 109,583,126 probably null Het
Zdhhc8 G A 16: 18,224,822 P505S probably damaging Het
Zfp292 C T 4: 34,839,899 V84I probably benign Het
Zfp712 T C 13: 67,040,727 T579A probably benign Het
Zfp788 G A 7: 41,650,214 R758Q probably benign Het
Other mutations in Copg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02324:Copg2 APN 6 30863534 critical splice donor site probably null
IGL02511:Copg2 APN 6 30858822 missense probably benign 0.00
R0612:Copg2 UTSW 6 30861469 splice site probably null
R0723:Copg2 UTSW 6 30815982 missense possibly damaging 0.94
R0742:Copg2 UTSW 6 30863613 splice site probably null
R1708:Copg2 UTSW 6 30824377 missense probably damaging 1.00
R1775:Copg2 UTSW 6 30810336 missense probably damaging 1.00
R1826:Copg2 UTSW 6 30812842 missense probably benign 0.00
R2011:Copg2 UTSW 6 30816741 critical splice donor site probably null
R2170:Copg2 UTSW 6 30812822 frame shift probably null
R2358:Copg2 UTSW 6 30826233 nonsense probably null
R2393:Copg2 UTSW 6 30810958 missense probably benign 0.00
R2512:Copg2 UTSW 6 30896656 splice site probably null
R4595:Copg2 UTSW 6 30749450 missense probably damaging 0.98
R4613:Copg2 UTSW 6 30811596 missense probably benign
R5243:Copg2 UTSW 6 30750627 missense probably benign 0.01
R5293:Copg2 UTSW 6 30826227 missense probably damaging 0.98
R6019:Copg2 UTSW 6 30810933 missense possibly damaging 0.54
R6235:Copg2 UTSW 6 30816071 missense probably damaging 1.00
R6605:Copg2 UTSW 6 30858822 missense probably benign 0.31
R6857:Copg2 UTSW 6 30863598 missense possibly damaging 0.94
R7132:Copg2 UTSW 6 30815996 missense probably benign 0.00
R7216:Copg2 UTSW 6 30885600 missense probably damaging 0.99
R7223:Copg2 UTSW 6 30812754 nonsense probably null
R7288:Copg2 UTSW 6 30824406 missense probably damaging 1.00
R7588:Copg2 UTSW 6 30811591 critical splice donor site probably null
R7993:Copg2 UTSW 6 30816162 missense probably damaging 1.00
R8005:Copg2 UTSW 6 30896697 start codon destroyed possibly damaging 0.63
R8191:Copg2 UTSW 6 30813730 missense probably benign 0.00
R8273:Copg2 UTSW 6 30816126 missense probably benign 0.05
R8853:Copg2 UTSW 6 30826180 missense probably benign 0.44
R9377:Copg2 UTSW 6 30816786 missense possibly damaging 0.92
R9443:Copg2 UTSW 6 30750579 missense probably benign 0.26
R9451:Copg2 UTSW 6 30816851 splice site probably benign
R9523:Copg2 UTSW 6 30749506 critical splice acceptor site probably null
R9583:Copg2 UTSW 6 30810464 nonsense probably null
R9698:Copg2 UTSW 6 30861438 missense probably damaging 1.00
Z1177:Copg2 UTSW 6 30809585 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGGTTAGACGCTATATTTACAAG -3'
(R):5'- GCAGCTTATAAGTTTATGAGGCAG -3'

Sequencing Primer
(F):5'- CTCAAAGACAGGAGCCAT -3'
(R):5'- GTAGGCTATCTACAGCTTCCTAATG -3'
Posted On 2022-03-25