Incidental Mutation 'R9256:Sorbs2'
ID 701871
Institutional Source Beutler Lab
Gene Symbol Sorbs2
Ensembl Gene ENSMUSG00000031626
Gene Name sorbin and SH3 domain containing 2
Synonyms 2010203O03Rik, 9430041O17Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9256 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 45960825-46280943 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 46248774 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 675 (V675G)
Ref Sequence ENSEMBL: ENSMUSP00000128000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067065] [ENSMUST00000067107] [ENSMUST00000125295] [ENSMUST00000130011] [ENSMUST00000132139] [ENSMUST00000135336] [ENSMUST00000171337] [ENSMUST00000138049] [ENSMUST00000139869] [ENSMUST00000153798] [ENSMUST00000211095]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000067065
AA Change: V540G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070720
Gene: ENSMUSG00000031626
AA Change: V540G

DomainStartEndE-ValueType
low complexity region 48 61 N/A INTRINSIC
low complexity region 105 121 N/A INTRINSIC
low complexity region 136 154 N/A INTRINSIC
low complexity region 266 283 N/A INTRINSIC
low complexity region 362 373 N/A INTRINSIC
low complexity region 606 618 N/A INTRINSIC
low complexity region 619 630 N/A INTRINSIC
SH3 845 900 5.1e-23 SMART
low complexity region 901 916 N/A INTRINSIC
SH3 920 977 3.9e-19 SMART
SH3 1023 1079 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067107
AA Change: V656G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067641
Gene: ENSMUSG00000031626
AA Change: V656G

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 382 399 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
SH3 962 1017 5.1e-23 SMART
low complexity region 1018 1033 N/A INTRINSIC
SH3 1037 1094 3.9e-19 SMART
SH3 1140 1196 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125295
AA Change: V595G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116768
Gene: ENSMUSG00000031626
AA Change: V595G

DomainStartEndE-ValueType
Sorb 6 56 9.63e-34 SMART
low complexity region 103 116 N/A INTRINSIC
low complexity region 160 176 N/A INTRINSIC
low complexity region 191 209 N/A INTRINSIC
low complexity region 321 338 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
SH3 900 955 5.1e-23 SMART
low complexity region 956 971 N/A INTRINSIC
SH3 975 1032 3.9e-19 SMART
SH3 1078 1134 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130011
SMART Domains Protein: ENSMUSP00000121619
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 113 163 1.01e-27 SMART
low complexity region 195 208 N/A INTRINSIC
low complexity region 252 268 N/A INTRINSIC
low complexity region 283 301 N/A INTRINSIC
low complexity region 366 383 N/A INTRINSIC
SH3 418 473 5.1e-23 SMART
low complexity region 474 489 N/A INTRINSIC
SH3 493 550 3.9e-19 SMART
SH3 596 652 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132139
SMART Domains Protein: ENSMUSP00000123250
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 144 194 9.63e-34 SMART
low complexity region 241 254 N/A INTRINSIC
low complexity region 298 314 N/A INTRINSIC
low complexity region 329 347 N/A INTRINSIC
low complexity region 431 448 N/A INTRINSIC
SH3 483 538 5.1e-23 SMART
low complexity region 539 554 N/A INTRINSIC
SH3 558 615 3.9e-19 SMART
SH3 636 707 2.16e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135336
AA Change: V656G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114286
Gene: ENSMUSG00000031626
AA Change: V656G

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 382 399 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
SH3 962 1017 5.1e-23 SMART
low complexity region 1018 1033 N/A INTRINSIC
SH3 1037 1094 3.9e-19 SMART
SH3 1140 1196 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171337
AA Change: V675G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128000
Gene: ENSMUSG00000031626
AA Change: V675G

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
low complexity region 741 753 N/A INTRINSIC
low complexity region 754 765 N/A INTRINSIC
SH3 980 1035 5.1e-23 SMART
low complexity region 1036 1051 N/A INTRINSIC
SH3 1055 1112 3.9e-19 SMART
SH3 1158 1214 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138049
SMART Domains Protein: ENSMUSP00000123503
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 167 217 1.01e-27 SMART
low complexity region 249 262 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
low complexity region 463 474 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139869
SMART Domains Protein: ENSMUSP00000121235
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 136 186 1.01e-27 SMART
low complexity region 218 231 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
SH3 389 444 5.1e-23 SMART
low complexity region 445 460 N/A INTRINSIC
SH3 464 521 3.9e-19 SMART
SH3 567 623 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140088
SMART Domains Protein: ENSMUSP00000114158
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 2 25 9.17e-1 SMART
low complexity region 57 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146627
SMART Domains Protein: ENSMUSP00000120487
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
low complexity region 41 59 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153798
SMART Domains Protein: ENSMUSP00000118353
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 136 186 9.63e-34 SMART
low complexity region 233 246 N/A INTRINSIC
low complexity region 351 368 N/A INTRINSIC
SH3 403 458 5.1e-23 SMART
low complexity region 459 474 N/A INTRINSIC
SH3 478 535 3.9e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155858
SMART Domains Protein: ENSMUSP00000122820
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
low complexity region 138 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211095
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arg and c-Abl represent the mammalian members of the Abelson family of non-receptor protein-tyrosine kinases. They interact with the Arg/Abl binding proteins via the SH3 domains present in the carboxy end of the latter group of proteins. This gene encodes the sorbin and SH3 domain containing 2 protein. It has three C-terminal SH3 domains and an N-terminal sorbin homology (SoHo) domain that interacts with lipid raft proteins. The subcellular localization of this protein in epithelial and cardiac muscle cells suggests that it functions as an adapter protein to assemble signaling complexes in stress fibers, and that it is a potential link between Abl family kinases and the actin cytoskeleton. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, reduced dendritic complexity, decreased excitatory synaptic transmission in dentate gyrus granule cells, a reduced acoustic startle response, and impaired long-term object recognition memory and contextual fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 A G 8: 46,945,930 (GRCm39) Y21C probably damaging Het
Adamts7 A T 9: 90,060,218 (GRCm39) I290F probably damaging Het
Adcy5 G A 16: 35,124,052 (GRCm39) V1244I probably damaging Het
Adnp A T 2: 168,025,945 (GRCm39) I450N probably damaging Het
AL732309.1 A T 2: 25,136,211 (GRCm39) M1K probably null Het
Alox15 C T 11: 70,236,370 (GRCm39) G510D possibly damaging Het
Arhgef16 C A 4: 154,363,502 (GRCm39) E685* probably null Het
Atp13a2 A G 4: 140,730,038 (GRCm39) E643G probably damaging Het
AW554918 C A 18: 25,423,061 (GRCm39) Q171K probably damaging Het
Bdkrb2 A G 12: 105,558,352 (GRCm39) T198A probably benign Het
C7 T C 15: 5,023,645 (GRCm39) E721G probably damaging Het
Cc2d2b T C 19: 40,797,848 (GRCm39) Y823H unknown Het
Cd74 T C 18: 60,944,366 (GRCm39) V192A probably benign Het
Cdc42bpg G A 19: 6,361,067 (GRCm39) A231T probably damaging Het
Cers6 G A 2: 68,777,706 (GRCm39) probably benign Het
Copg2 T C 6: 30,788,637 (GRCm39) I555M probably benign Het
Cracd T G 5: 76,988,757 (GRCm39) V36G unknown Het
Crnkl1 A G 2: 145,770,216 (GRCm39) V209A possibly damaging Het
Dock7 T C 4: 98,971,272 (GRCm39) T98A Het
Enpp5 T C 17: 44,396,414 (GRCm39) I442T probably benign Het
Fbxw19 T C 9: 109,310,641 (GRCm39) Y427C probably damaging Het
Fktn T C 4: 53,744,653 (GRCm39) V311A probably benign Het
Fyb1 T G 15: 6,674,358 (GRCm39) S665A possibly damaging Het
Igkv6-20 T C 6: 70,313,417 (GRCm39) Y16C probably benign Het
Ints10 A G 8: 69,261,129 (GRCm39) R370G possibly damaging Het
Iqub A T 6: 24,446,198 (GRCm39) I742N possibly damaging Het
Kcnn3 T C 3: 89,574,407 (GRCm39) Y640H probably damaging Het
Lrp2 A G 2: 69,341,303 (GRCm39) V959A probably benign Het
Marcksl1 A G 4: 129,408,816 (GRCm39) S132G probably benign Het
Mfsd4b3-ps T A 10: 39,824,010 (GRCm39) K83N probably damaging Het
Mib1 A G 18: 10,760,862 (GRCm39) E384G possibly damaging Het
Morn5 G T 2: 35,939,553 (GRCm39) G5W probably damaging Het
Mrpl46 A G 7: 78,432,671 (GRCm39) S36P probably benign Het
Mtif2 T C 11: 29,490,777 (GRCm39) F494L probably benign Het
Naalad2 T C 9: 18,274,534 (GRCm39) N336S probably benign Het
Nepro A G 16: 44,544,790 (GRCm39) N22S probably benign Het
Nos1 G C 5: 118,017,402 (GRCm39) R255P probably benign Het
Or10x4 C T 1: 174,219,109 (GRCm39) T158I probably benign Het
Or1e1f A T 11: 73,856,135 (GRCm39) I234F probably benign Het
Or2d36 T C 7: 106,747,387 (GRCm39) I288T probably damaging Het
Or8c16 T A 9: 38,130,498 (GRCm39) Y123* probably null Het
Or9r7 A G 10: 129,962,335 (GRCm39) V197A possibly damaging Het
Pcnx1 A T 12: 82,020,047 (GRCm39) N724Y Het
Pde8b G A 13: 95,164,204 (GRCm39) R669C probably damaging Het
Pkhd1l1 T A 15: 44,397,290 (GRCm39) probably null Het
Pls1 A G 9: 95,655,696 (GRCm39) V352A probably damaging Het
Prb1b T C 6: 132,288,972 (GRCm39) N284S unknown Het
Prtg A T 9: 72,758,977 (GRCm39) I444F probably damaging Het
Ptprb A T 10: 116,219,776 (GRCm39) H1998L probably damaging Het
Qrich2 A T 11: 116,356,450 (GRCm39) V133D probably benign Het
Rab35 C A 5: 115,778,246 (GRCm39) R71S probably damaging Het
Scgb2b12 A G 7: 32,026,054 (GRCm39) L46P probably damaging Het
Sdha A T 13: 74,475,483 (GRCm39) probably benign Het
Sdr39u1 C A 14: 56,135,209 (GRCm39) V245F probably benign Het
Sgo2a T A 1: 58,058,772 (GRCm39) V1117E possibly damaging Het
Slc12a2 T C 18: 58,074,867 (GRCm39) S1154P probably damaging Het
Slc6a1 A T 6: 114,287,554 (GRCm39) Q441L possibly damaging Het
Smtnl2 A T 11: 72,293,835 (GRCm39) probably null Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tmem38b A T 4: 53,848,924 (GRCm39) I110F probably damaging Het
Ubqln1 A G 13: 58,325,721 (GRCm39) I573T probably damaging Het
Usp9y T C Y: 1,356,235 (GRCm39) I1155M possibly damaging Het
Vipr1 A G 9: 121,490,118 (GRCm39) I164V probably benign Het
Vps13b T G 15: 35,623,925 (GRCm39) S1281A possibly damaging Het
Vps13d A G 4: 144,882,374 (GRCm39) L1073P Het
Wipi1 C T 11: 109,473,952 (GRCm39) probably null Het
Zdhhc8 G A 16: 18,042,686 (GRCm39) P505S probably damaging Het
Zfp292 C T 4: 34,839,899 (GRCm39) V84I probably benign Het
Zfp712 T C 13: 67,188,791 (GRCm39) T579A probably benign Het
Zfp788 G A 7: 41,299,638 (GRCm39) R758Q probably benign Het
Other mutations in Sorbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Sorbs2 APN 8 46,252,743 (GRCm39) splice site probably null
IGL00964:Sorbs2 APN 8 46,248,714 (GRCm39) missense probably damaging 0.97
IGL01101:Sorbs2 APN 8 46,198,460 (GRCm39) missense possibly damaging 0.93
IGL01586:Sorbs2 APN 8 46,248,631 (GRCm39) missense probably damaging 1.00
IGL01611:Sorbs2 APN 8 46,248,381 (GRCm39) missense probably null
IGL01662:Sorbs2 APN 8 46,256,866 (GRCm39) splice site probably benign
IGL01970:Sorbs2 APN 8 46,198,840 (GRCm39) missense probably damaging 1.00
IGL02169:Sorbs2 APN 8 46,276,786 (GRCm39) missense probably damaging 0.98
IGL02685:Sorbs2 APN 8 46,256,877 (GRCm39) missense probably benign 0.00
IGL03036:Sorbs2 APN 8 46,235,902 (GRCm39) missense probably benign
IGL03151:Sorbs2 APN 8 46,252,750 (GRCm39) missense probably benign 0.01
IGL03164:Sorbs2 APN 8 46,235,911 (GRCm39) missense probably benign 0.01
IGL03350:Sorbs2 APN 8 46,258,844 (GRCm39) missense probably damaging 0.99
BB001:Sorbs2 UTSW 8 46,248,507 (GRCm39) missense probably damaging 1.00
BB011:Sorbs2 UTSW 8 46,248,507 (GRCm39) missense probably damaging 1.00
R0058:Sorbs2 UTSW 8 46,249,300 (GRCm39) missense probably damaging 1.00
R0058:Sorbs2 UTSW 8 46,238,291 (GRCm39) splice site probably null
R0233:Sorbs2 UTSW 8 46,222,866 (GRCm39) missense probably damaging 1.00
R0233:Sorbs2 UTSW 8 46,222,866 (GRCm39) missense probably damaging 1.00
R0265:Sorbs2 UTSW 8 46,238,374 (GRCm39) splice site probably benign
R0306:Sorbs2 UTSW 8 46,248,767 (GRCm39) missense probably benign 0.00
R0308:Sorbs2 UTSW 8 46,248,167 (GRCm39) nonsense probably null
R0638:Sorbs2 UTSW 8 46,249,347 (GRCm39) missense probably damaging 1.00
R0940:Sorbs2 UTSW 8 46,249,539 (GRCm39) missense probably benign 0.39
R1110:Sorbs2 UTSW 8 46,248,767 (GRCm39) missense probably benign 0.13
R1160:Sorbs2 UTSW 8 46,223,613 (GRCm39) missense probably damaging 1.00
R1226:Sorbs2 UTSW 8 46,248,656 (GRCm39) missense probably damaging 1.00
R1271:Sorbs2 UTSW 8 46,249,004 (GRCm39) missense probably damaging 1.00
R1440:Sorbs2 UTSW 8 46,243,000 (GRCm39) splice site probably benign
R1514:Sorbs2 UTSW 8 46,222,866 (GRCm39) missense probably damaging 1.00
R1557:Sorbs2 UTSW 8 46,212,234 (GRCm39) splice site probably benign
R1582:Sorbs2 UTSW 8 46,258,814 (GRCm39) missense probably damaging 0.99
R1626:Sorbs2 UTSW 8 46,222,891 (GRCm39) missense probably damaging 1.00
R1700:Sorbs2 UTSW 8 46,254,021 (GRCm39) missense probably damaging 1.00
R1759:Sorbs2 UTSW 8 46,216,056 (GRCm39) makesense probably null
R1766:Sorbs2 UTSW 8 46,223,613 (GRCm39) missense probably damaging 1.00
R1782:Sorbs2 UTSW 8 46,258,733 (GRCm39) missense probably damaging 1.00
R1932:Sorbs2 UTSW 8 46,249,389 (GRCm39) missense probably benign 0.01
R1954:Sorbs2 UTSW 8 46,198,775 (GRCm39) missense probably benign 0.23
R2060:Sorbs2 UTSW 8 46,228,666 (GRCm39) missense probably damaging 1.00
R2149:Sorbs2 UTSW 8 46,248,480 (GRCm39) missense probably damaging 0.99
R2568:Sorbs2 UTSW 8 46,248,407 (GRCm39) nonsense probably null
R3812:Sorbs2 UTSW 8 46,216,067 (GRCm39) missense probably benign 0.00
R3831:Sorbs2 UTSW 8 46,248,132 (GRCm39) missense probably damaging 1.00
R3975:Sorbs2 UTSW 8 46,225,747 (GRCm39) critical splice donor site probably null
R4033:Sorbs2 UTSW 8 46,228,632 (GRCm39) missense probably damaging 1.00
R4714:Sorbs2 UTSW 8 46,248,330 (GRCm39) missense possibly damaging 0.89
R4828:Sorbs2 UTSW 8 46,194,652 (GRCm39) intron probably benign
R4926:Sorbs2 UTSW 8 46,249,254 (GRCm39) missense probably benign 0.03
R5027:Sorbs2 UTSW 8 46,199,571 (GRCm39) splice site probably null
R5118:Sorbs2 UTSW 8 46,248,822 (GRCm39) missense probably damaging 1.00
R5159:Sorbs2 UTSW 8 46,248,767 (GRCm39) missense probably benign 0.00
R5342:Sorbs2 UTSW 8 46,249,050 (GRCm39) missense probably damaging 0.96
R5390:Sorbs2 UTSW 8 46,272,778 (GRCm39) missense probably damaging 1.00
R5436:Sorbs2 UTSW 8 46,249,038 (GRCm39) missense probably damaging 1.00
R5655:Sorbs2 UTSW 8 46,194,618 (GRCm39) critical splice donor site probably null
R5687:Sorbs2 UTSW 8 46,228,669 (GRCm39) missense probably damaging 1.00
R5695:Sorbs2 UTSW 8 46,245,912 (GRCm39) missense probably benign 0.27
R5733:Sorbs2 UTSW 8 46,212,226 (GRCm39) missense probably damaging 1.00
R5928:Sorbs2 UTSW 8 46,216,220 (GRCm39) missense probably damaging 1.00
R5949:Sorbs2 UTSW 8 46,222,934 (GRCm39) critical splice donor site probably null
R6341:Sorbs2 UTSW 8 46,223,615 (GRCm39) missense probably damaging 1.00
R6620:Sorbs2 UTSW 8 46,249,213 (GRCm39) missense probably damaging 1.00
R6761:Sorbs2 UTSW 8 46,225,651 (GRCm39) missense probably damaging 1.00
R7349:Sorbs2 UTSW 8 46,248,860 (GRCm39) nonsense probably null
R7404:Sorbs2 UTSW 8 46,212,233 (GRCm39) splice site probably null
R7524:Sorbs2 UTSW 8 46,248,693 (GRCm39) missense probably benign 0.00
R7809:Sorbs2 UTSW 8 46,198,465 (GRCm39) missense possibly damaging 0.93
R7820:Sorbs2 UTSW 8 46,249,593 (GRCm39) missense probably null 0.16
R7924:Sorbs2 UTSW 8 46,248,507 (GRCm39) missense probably damaging 1.00
R8285:Sorbs2 UTSW 8 46,249,104 (GRCm39) missense probably damaging 0.98
R8696:Sorbs2 UTSW 8 46,248,686 (GRCm39) missense possibly damaging 0.95
R8927:Sorbs2 UTSW 8 46,248,952 (GRCm39) missense probably damaging 1.00
R8928:Sorbs2 UTSW 8 46,248,952 (GRCm39) missense probably damaging 1.00
R9005:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9006:Sorbs2 UTSW 8 46,258,858 (GRCm39) missense possibly damaging 0.95
R9016:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9017:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9091:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9196:Sorbs2 UTSW 8 46,258,864 (GRCm39) missense probably benign 0.12
R9282:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9283:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9384:Sorbs2 UTSW 8 46,258,864 (GRCm39) missense probably benign 0.12
R9624:Sorbs2 UTSW 8 46,228,690 (GRCm39) missense possibly damaging 0.89
R9664:Sorbs2 UTSW 8 46,276,788 (GRCm39) missense probably benign 0.05
Z1176:Sorbs2 UTSW 8 46,243,062 (GRCm39) missense probably null 0.96
Z1177:Sorbs2 UTSW 8 46,235,996 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCTGCAGTACGAGAAGGAG -3'
(R):5'- GTCACTTTCACTACAAAAGGACGAC -3'

Sequencing Primer
(F):5'- ACGGATGGAGCCAGTCTTC -3'
(R):5'- GACCCTTCGACGTGAACG -3'
Posted On 2022-03-25