Incidental Mutation 'R9256:Enpp5'
ID 701903
Institutional Source Beutler Lab
Gene Symbol Enpp5
Ensembl Gene ENSMUSG00000023960
Gene Name ectonucleotide pyrophosphatase/phosphodiesterase 5
Synonyms D17Abb1e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9256 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 44078813-44086567 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 44085523 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 442 (I442T)
Ref Sequence ENSEMBL: ENSMUSP00000024756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024756] [ENSMUST00000126032] [ENSMUST00000154166]
AlphaFold Q9EQG7
Predicted Effect probably benign
Transcript: ENSMUST00000024756
AA Change: I442T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000024756
Gene: ENSMUSG00000023960
AA Change: I442T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Phosphodiest 30 342 7.1e-91 PFAM
transmembrane domain 430 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126032
Predicted Effect probably benign
Transcript: ENSMUST00000154166
AA Change: I442T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000122767
Gene: ENSMUSG00000023960
AA Change: I442T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Phosphodiest 30 342 2.1e-86 PFAM
transmembrane domain 430 452 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I transmembrane glycoprotein. Studies in rat suggest the encoded protein may play a role in neuronal cell communications. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 A G 8: 46,492,893 Y21C probably damaging Het
Adamts7 A T 9: 90,178,165 I290F probably damaging Het
Adcy5 G A 16: 35,303,682 V1244I probably damaging Het
Adnp A T 2: 168,184,025 I450N probably damaging Het
AL732309.1 A T 2: 25,246,199 M1K probably null Het
Alox15 C T 11: 70,345,544 G510D possibly damaging Het
Arhgef16 C A 4: 154,279,045 E685* probably null Het
Atp13a2 A G 4: 141,002,727 E643G probably damaging Het
AW554918 C A 18: 25,290,004 Q171K probably damaging Het
Bdkrb2 A G 12: 105,592,093 T198A probably benign Het
C530008M17Rik T G 5: 76,840,910 V36G unknown Het
C7 T C 15: 4,994,163 E721G probably damaging Het
Cc2d2b T C 19: 40,809,404 Y823H unknown Het
Cd74 T C 18: 60,811,294 V192A probably benign Het
Cdc42bpg G A 19: 6,311,037 A231T probably damaging Het
Cers6 G A 2: 68,947,362 probably benign Het
Copg2 T C 6: 30,811,702 I555M probably benign Het
Crnkl1 A G 2: 145,928,296 V209A possibly damaging Het
Dock7 T C 4: 99,083,035 T98A Het
Fbxw19 T C 9: 109,481,573 Y427C probably damaging Het
Fktn T C 4: 53,744,653 V311A probably benign Het
Fyb T G 15: 6,644,877 S665A possibly damaging Het
Igkv6-20 T C 6: 70,336,433 Y16C probably benign Het
Ints10 A G 8: 68,808,477 R370G possibly damaging Het
Iqub A T 6: 24,446,199 I742N possibly damaging Het
Kcnn3 T C 3: 89,667,100 Y640H probably damaging Het
Lrp2 A G 2: 69,510,959 V959A probably benign Het
Marcksl1 A G 4: 129,515,023 S132G probably benign Het
Mfsd4b3 T A 10: 39,948,014 K83N probably damaging Het
Mib1 A G 18: 10,760,862 E384G possibly damaging Het
Morn5 G T 2: 36,049,541 G5W probably damaging Het
Mrpl46 A G 7: 78,782,923 S36P probably benign Het
Mtif2 T C 11: 29,540,777 F494L probably benign Het
Naalad2 T C 9: 18,363,238 N336S probably benign Het
Nepro A G 16: 44,724,427 N22S probably benign Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Olfr248 C T 1: 174,391,543 T158I probably benign Het
Olfr397 A T 11: 73,965,309 I234F probably benign Het
Olfr716 T C 7: 107,148,180 I288T probably damaging Het
Olfr824 A G 10: 130,126,466 V197A possibly damaging Het
Olfr894 T A 9: 38,219,202 Y123* probably null Het
Pcnx A T 12: 81,973,273 N724Y Het
Pde8b G A 13: 95,027,696 R669C probably damaging Het
Pkhd1l1 T A 15: 44,533,894 probably null Het
Pls1 A G 9: 95,773,643 V352A probably damaging Het
Prpmp5 T C 6: 132,312,009 N284S unknown Het
Prtg A T 9: 72,851,695 I444F probably damaging Het
Ptprb A T 10: 116,383,871 H1998L probably damaging Het
Qrich2 A T 11: 116,465,624 V133D probably benign Het
Rab35 C A 5: 115,640,187 R71S probably damaging Het
Scgb2b12 A G 7: 32,326,629 L46P probably damaging Het
Sdha A T 13: 74,327,364 probably benign Het
Sdr39u1 C A 14: 55,897,752 V245F probably benign Het
Sgo2a T A 1: 58,019,613 V1117E possibly damaging Het
Slc12a2 T C 18: 57,941,795 S1154P probably damaging Het
Slc6a1 A T 6: 114,310,593 Q441L possibly damaging Het
Smtnl2 A T 11: 72,403,009 probably null Het
Sorbs2 T G 8: 45,795,737 V675G probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tmem38b A T 4: 53,848,924 I110F probably damaging Het
Ubqln1 A G 13: 58,177,907 I573T probably damaging Het
Usp9y T C Y: 1,356,235 I1155M possibly damaging Het
Vipr1 A G 9: 121,661,052 I164V probably benign Het
Vps13b T G 15: 35,623,779 S1281A possibly damaging Het
Vps13d A G 4: 145,155,804 L1073P Het
Wipi1 C T 11: 109,583,126 probably null Het
Zdhhc8 G A 16: 18,224,822 P505S probably damaging Het
Zfp292 C T 4: 34,839,899 V84I probably benign Het
Zfp712 T C 13: 67,040,727 T579A probably benign Het
Zfp788 G A 7: 41,650,214 R758Q probably benign Het
Other mutations in Enpp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Enpp5 APN 17 44085197 splice site probably benign
IGL01593:Enpp5 APN 17 44080721 missense probably benign
IGL01654:Enpp5 APN 17 44081175 missense possibly damaging 0.82
IGL02120:Enpp5 APN 17 44080845 missense probably benign 0.04
IGL02142:Enpp5 APN 17 44085577 missense probably benign 0.01
IGL02531:Enpp5 APN 17 44080952 missense probably damaging 1.00
IGL02630:Enpp5 APN 17 44082875 missense probably damaging 1.00
Cacao UTSW 17 44085576 missense probably benign 0.00
canola UTSW 17 44085264 missense probably damaging 1.00
R1101:Enpp5 UTSW 17 44081367 missense possibly damaging 0.77
R2074:Enpp5 UTSW 17 44085373 missense probably benign 0.25
R2679:Enpp5 UTSW 17 44085388 missense probably damaging 1.00
R4739:Enpp5 UTSW 17 44081136 missense probably damaging 1.00
R4817:Enpp5 UTSW 17 44080980 makesense probably null
R5152:Enpp5 UTSW 17 44081133 missense probably damaging 1.00
R6021:Enpp5 UTSW 17 44085319 missense probably benign 0.22
R6160:Enpp5 UTSW 17 44081368 missense possibly damaging 0.77
R6330:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6385:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6387:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6452:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6454:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6461:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6462:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6463:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6469:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6470:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6471:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6473:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6505:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6563:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6564:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6760:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6812:Enpp5 UTSW 17 44085576 missense probably benign 0.00
R6821:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6824:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6963:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6965:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7169:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7171:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7375:Enpp5 UTSW 17 44080977 missense probably benign 0.02
R7393:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7394:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7411:Enpp5 UTSW 17 44081475 missense probably damaging 1.00
R7412:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7446:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7447:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7560:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7561:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7589:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7590:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7591:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R8211:Enpp5 UTSW 17 44081511 critical splice donor site probably null
R9321:Enpp5 UTSW 17 44082798 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CACAGATCTGTACTCACTGCTCTG -3'
(R):5'- TGAGAAGCTGAAGGGTCACC -3'

Sequencing Primer
(F):5'- GTACTCACTGCTCTGCCACC -3'
(R):5'- GTCACCGCTGATAGAATTTCGGAC -3'
Posted On 2022-03-25