Incidental Mutation 'R9257:Zdbf2'
ID 701913
Institutional Source Beutler Lab
Gene Symbol Zdbf2
Ensembl Gene ENSMUSG00000027520
Gene Name zinc finger, DBF-type containing 2
Synonyms 4930431J08Rik, 9330107J05Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R9257 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 63312424-63353735 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 63345400 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 1260 (G1260R)
Ref Sequence ENSEMBL: ENSMUSP00000029025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]
AlphaFold Q5SS00
Predicted Effect probably damaging
Transcript: ENSMUST00000029025
AA Change: G1260R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: G1260R

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114132
AA Change: G1260R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: G1260R

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T A 2: 151,315,627 (GRCm39) D17V probably benign Het
9130401M01Rik A C 15: 57,892,414 (GRCm39) H128Q possibly damaging Het
Abcd2 T C 15: 91,075,315 (GRCm39) Y166C possibly damaging Het
Adamtsl4 C A 3: 95,588,575 (GRCm39) V546F probably damaging Het
Als2cl T A 9: 110,723,755 (GRCm39) V717E probably damaging Het
Atm A G 9: 53,407,150 (GRCm39) probably null Het
Atp2c1 C A 9: 105,291,851 (GRCm39) E904* probably null Het
Ccdc88c G A 12: 100,889,474 (GRCm39) S1523F possibly damaging Het
Cds1 A T 5: 101,963,751 (GRCm39) I357F probably benign Het
Cilp T A 9: 65,174,451 (GRCm39) V13D possibly damaging Het
Copz2 A G 11: 96,748,386 (GRCm39) D180G possibly damaging Het
Cpsf1 C T 15: 76,484,992 (GRCm39) E546K probably benign Het
Ctsm T C 13: 61,684,413 (GRCm39) N320D probably damaging Het
Fat3 G A 9: 15,907,863 (GRCm39) T2713I probably benign Het
Fcrl5 T A 3: 87,343,195 (GRCm39) S2T probably benign Het
Fgfr4 T C 13: 55,315,974 (GRCm39) S796P unknown Het
Flrt3 A G 2: 140,502,159 (GRCm39) F490L probably benign Het
Fras1 A T 5: 96,910,359 (GRCm39) I3263F probably damaging Het
Hydin A T 8: 111,301,648 (GRCm39) D3793V probably damaging Het
Kif5c T A 2: 49,590,604 (GRCm39) L269* probably null Het
Klhl32 A G 4: 24,649,608 (GRCm39) V396A probably benign Het
Krt1c C T 15: 101,724,926 (GRCm39) R228Q probably benign Het
Lcn9 T C 2: 25,714,784 (GRCm39) probably null Het
Lingo4 A C 3: 94,310,676 (GRCm39) D538A probably benign Het
Lonp1 G T 17: 56,927,516 (GRCm39) Y299* probably null Het
Mettl16 T A 11: 74,708,127 (GRCm39) V442D possibly damaging Het
Mettl25b G T 3: 87,831,768 (GRCm39) Q397K probably benign Het
Mis18bp1 A G 12: 65,180,631 (GRCm39) V950A probably benign Het
Mndal A T 1: 173,690,274 (GRCm39) V352E probably damaging Het
Mrpl55 T C 11: 59,096,578 (GRCm39) V117A probably benign Het
Muc6 T A 7: 141,226,738 (GRCm39) S1430C unknown Het
Myh11 C A 16: 14,087,120 (GRCm39) G119C Het
Myorg T C 4: 41,499,030 (GRCm39) D200G probably benign Het
Neu1 A G 17: 35,150,396 (GRCm39) D5G probably benign Het
Nrcam T A 12: 44,610,837 (GRCm39) D512E probably benign Het
Nup214 T G 2: 31,923,347 (GRCm39) V1292G possibly damaging Het
Nwd1 T A 8: 73,397,566 (GRCm39) L602M probably damaging Het
Or6c3b C A 10: 129,527,003 (GRCm39) L302F probably benign Het
Pck2 G T 14: 55,782,702 (GRCm39) G379W probably damaging Het
Per2 C T 1: 91,376,445 (GRCm39) V143M probably damaging Het
Pfkl A T 10: 77,825,489 (GRCm39) Y634N probably damaging Het
Phlpp1 A G 1: 106,100,281 (GRCm39) D183G possibly damaging Het
Pkdrej T A 15: 85,700,098 (GRCm39) Y1946F probably damaging Het
Plxna4 C T 6: 32,139,018 (GRCm39) D1717N probably damaging Het
Ppp1r14bl G T 1: 23,141,275 (GRCm39) T13N probably benign Het
Pramel23 T A 4: 143,425,685 (GRCm39) D86V probably damaging Het
Prdm16 A T 4: 154,422,155 (GRCm39) V879E probably damaging Het
Prr23a3 T C 9: 98,747,298 (GRCm39) V84A probably benign Het
Ptp4a1 A G 1: 30,985,346 (GRCm39) probably benign Het
Rhbdf1 T C 11: 32,160,754 (GRCm39) H634R probably benign Het
Rmi2 T C 16: 10,653,089 (GRCm39) S46P probably benign Het
Rsf1 A T 7: 97,334,918 (GRCm39) E1350D Het
Slc6a6 T A 6: 91,716,952 (GRCm39) F276Y possibly damaging Het
Sppl3 A G 5: 115,221,532 (GRCm39) Y120C probably benign Het
Stard13 G T 5: 150,985,956 (GRCm39) A518E probably benign Het
Taf2 A T 15: 54,929,409 (GRCm39) V49E possibly damaging Het
Tas2r140 T A 6: 40,468,592 (GRCm39) W141R probably damaging Het
Tlx2 T A 6: 83,047,035 (GRCm39) H9L unknown Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tmem132d G A 5: 127,861,491 (GRCm39) Q877* probably null Het
Unc5d A T 8: 29,215,174 (GRCm39) probably null Het
Upp1 A T 11: 9,075,661 (GRCm39) T4S probably benign Het
Uros A T 7: 133,292,853 (GRCm39) I146N probably damaging Het
Vsig10 A T 5: 117,463,131 (GRCm39) D119V probably benign Het
Washc2 C A 6: 116,193,069 (GRCm39) Y138* probably null Het
Ywhah T A 5: 33,184,095 (GRCm39) D99E probably benign Het
Zfp663 T C 2: 165,195,974 (GRCm39) T82A probably benign Het
Zfp831 T A 2: 174,488,156 (GRCm39) C944S possibly damaging Het
Other mutations in Zdbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Zdbf2 APN 1 63,345,673 (GRCm39) missense possibly damaging 0.92
IGL00796:Zdbf2 APN 1 63,346,364 (GRCm39) missense probably benign 0.04
IGL00801:Zdbf2 APN 1 63,342,197 (GRCm39) missense possibly damaging 0.66
IGL02803:Zdbf2 APN 1 63,342,236 (GRCm39) missense possibly damaging 0.46
R0143:Zdbf2 UTSW 1 63,347,233 (GRCm39) missense probably benign 0.01
R0147:Zdbf2 UTSW 1 63,343,165 (GRCm39) nonsense probably null
R0148:Zdbf2 UTSW 1 63,343,165 (GRCm39) nonsense probably null
R0433:Zdbf2 UTSW 1 63,345,302 (GRCm39) missense possibly damaging 0.46
R0502:Zdbf2 UTSW 1 63,344,449 (GRCm39) missense possibly damaging 0.66
R0645:Zdbf2 UTSW 1 63,344,109 (GRCm39) missense possibly damaging 0.81
R0765:Zdbf2 UTSW 1 63,344,882 (GRCm39) missense possibly damaging 0.46
R1068:Zdbf2 UTSW 1 63,342,589 (GRCm39) missense possibly damaging 0.94
R1216:Zdbf2 UTSW 1 63,342,161 (GRCm39) missense possibly damaging 0.83
R1235:Zdbf2 UTSW 1 63,348,232 (GRCm39) missense possibly damaging 0.66
R1352:Zdbf2 UTSW 1 63,342,212 (GRCm39) missense probably damaging 0.96
R1402:Zdbf2 UTSW 1 63,342,786 (GRCm39) missense possibly damaging 0.46
R1402:Zdbf2 UTSW 1 63,342,786 (GRCm39) missense possibly damaging 0.46
R1435:Zdbf2 UTSW 1 63,342,199 (GRCm39) missense possibly damaging 0.66
R1562:Zdbf2 UTSW 1 63,342,747 (GRCm39) missense possibly damaging 0.83
R1624:Zdbf2 UTSW 1 63,343,018 (GRCm39) missense possibly damaging 0.66
R1635:Zdbf2 UTSW 1 63,343,493 (GRCm39) missense possibly damaging 0.92
R1644:Zdbf2 UTSW 1 63,348,131 (GRCm39) missense possibly damaging 0.66
R1662:Zdbf2 UTSW 1 63,343,408 (GRCm39) nonsense probably null
R1700:Zdbf2 UTSW 1 63,341,900 (GRCm39) missense unknown
R1720:Zdbf2 UTSW 1 63,342,436 (GRCm39) missense possibly damaging 0.46
R1853:Zdbf2 UTSW 1 63,344,701 (GRCm39) frame shift probably null
R1854:Zdbf2 UTSW 1 63,344,701 (GRCm39) frame shift probably null
R1973:Zdbf2 UTSW 1 63,348,860 (GRCm39) missense unknown
R2336:Zdbf2 UTSW 1 63,342,623 (GRCm39) missense probably benign 0.00
R2428:Zdbf2 UTSW 1 63,344,774 (GRCm39) missense probably benign 0.04
R3010:Zdbf2 UTSW 1 63,342,224 (GRCm39) missense possibly damaging 0.92
R3034:Zdbf2 UTSW 1 63,343,364 (GRCm39) missense probably damaging 0.96
R3079:Zdbf2 UTSW 1 63,346,636 (GRCm39) missense probably benign 0.05
R3196:Zdbf2 UTSW 1 63,347,579 (GRCm39) missense possibly damaging 0.46
R3711:Zdbf2 UTSW 1 63,347,830 (GRCm39) missense possibly damaging 0.83
R3845:Zdbf2 UTSW 1 63,347,483 (GRCm39) missense possibly damaging 0.66
R4093:Zdbf2 UTSW 1 63,348,940 (GRCm39) missense possibly damaging 0.83
R4250:Zdbf2 UTSW 1 63,342,020 (GRCm39) missense possibly damaging 0.46
R4592:Zdbf2 UTSW 1 63,345,750 (GRCm39) missense possibly damaging 0.82
R4721:Zdbf2 UTSW 1 63,347,951 (GRCm39) missense possibly damaging 0.46
R4779:Zdbf2 UTSW 1 63,342,397 (GRCm39) missense possibly damaging 0.66
R4928:Zdbf2 UTSW 1 63,347,973 (GRCm39) missense possibly damaging 0.81
R4943:Zdbf2 UTSW 1 63,342,073 (GRCm39) missense possibly damaging 0.92
R5025:Zdbf2 UTSW 1 63,342,809 (GRCm39) missense possibly damaging 0.82
R5095:Zdbf2 UTSW 1 63,348,232 (GRCm39) missense possibly damaging 0.66
R5149:Zdbf2 UTSW 1 63,344,062 (GRCm39) missense possibly damaging 0.83
R5326:Zdbf2 UTSW 1 63,343,570 (GRCm39) missense possibly damaging 0.66
R5341:Zdbf2 UTSW 1 63,347,092 (GRCm39) missense probably benign 0.27
R5511:Zdbf2 UTSW 1 63,344,836 (GRCm39) missense probably benign 0.03
R5809:Zdbf2 UTSW 1 63,345,035 (GRCm39) missense possibly damaging 0.90
R5902:Zdbf2 UTSW 1 63,345,685 (GRCm39) missense possibly damaging 0.83
R6162:Zdbf2 UTSW 1 63,319,977 (GRCm39) start gained probably benign
R6245:Zdbf2 UTSW 1 63,343,592 (GRCm39) missense possibly damaging 0.46
R6332:Zdbf2 UTSW 1 63,346,981 (GRCm39) missense possibly damaging 0.66
R6361:Zdbf2 UTSW 1 63,342,480 (GRCm39) missense possibly damaging 0.66
R6489:Zdbf2 UTSW 1 63,346,637 (GRCm39) missense possibly damaging 0.46
R6517:Zdbf2 UTSW 1 63,344,679 (GRCm39) missense possibly damaging 0.81
R6624:Zdbf2 UTSW 1 63,343,073 (GRCm39) missense possibly damaging 0.46
R6643:Zdbf2 UTSW 1 63,343,667 (GRCm39) missense possibly damaging 0.82
R6786:Zdbf2 UTSW 1 63,343,679 (GRCm39) missense possibly damaging 0.46
R6808:Zdbf2 UTSW 1 63,347,687 (GRCm39) missense possibly damaging 0.66
R6896:Zdbf2 UTSW 1 63,348,031 (GRCm39) missense probably damaging 0.98
R6997:Zdbf2 UTSW 1 63,329,925 (GRCm39) missense probably benign 0.09
R7011:Zdbf2 UTSW 1 63,345,925 (GRCm39) missense possibly damaging 0.66
R7058:Zdbf2 UTSW 1 63,346,563 (GRCm39) missense possibly damaging 0.66
R7066:Zdbf2 UTSW 1 63,346,718 (GRCm39) missense probably benign
R7177:Zdbf2 UTSW 1 63,334,120 (GRCm39) missense possibly damaging 0.94
R7184:Zdbf2 UTSW 1 63,345,664 (GRCm39) missense possibly damaging 0.92
R7273:Zdbf2 UTSW 1 63,342,563 (GRCm39) missense possibly damaging 0.90
R7387:Zdbf2 UTSW 1 63,343,198 (GRCm39) missense possibly damaging 0.46
R7468:Zdbf2 UTSW 1 63,346,669 (GRCm39) missense probably benign
R7695:Zdbf2 UTSW 1 63,346,529 (GRCm39) missense possibly damaging 0.83
R7712:Zdbf2 UTSW 1 63,344,530 (GRCm39) missense possibly damaging 0.83
R7735:Zdbf2 UTSW 1 63,343,264 (GRCm39) missense possibly damaging 0.66
R7736:Zdbf2 UTSW 1 63,347,166 (GRCm39) nonsense probably null
R7759:Zdbf2 UTSW 1 63,347,535 (GRCm39) missense possibly damaging 0.46
R7796:Zdbf2 UTSW 1 63,342,583 (GRCm39) missense possibly damaging 0.90
R7908:Zdbf2 UTSW 1 63,345,986 (GRCm39) missense possibly damaging 0.46
R7970:Zdbf2 UTSW 1 63,343,330 (GRCm39) missense possibly damaging 0.92
R8076:Zdbf2 UTSW 1 63,345,260 (GRCm39) missense possibly damaging 0.92
R8152:Zdbf2 UTSW 1 63,345,572 (GRCm39) missense possibly damaging 0.92
R8195:Zdbf2 UTSW 1 63,343,225 (GRCm39) missense possibly damaging 0.83
R8272:Zdbf2 UTSW 1 63,345,142 (GRCm39) missense probably benign
R8306:Zdbf2 UTSW 1 63,343,234 (GRCm39) missense possibly damaging 0.66
R8309:Zdbf2 UTSW 1 63,345,750 (GRCm39) missense possibly damaging 0.82
R8323:Zdbf2 UTSW 1 63,342,073 (GRCm39) missense possibly damaging 0.46
R8400:Zdbf2 UTSW 1 63,344,135 (GRCm39) missense possibly damaging 0.92
R8443:Zdbf2 UTSW 1 63,345,166 (GRCm39) missense possibly damaging 0.83
R8460:Zdbf2 UTSW 1 63,348,729 (GRCm39) small deletion probably benign
R8528:Zdbf2 UTSW 1 63,342,545 (GRCm39) missense possibly damaging 0.82
R8812:Zdbf2 UTSW 1 63,347,272 (GRCm39) missense probably benign 0.00
R8962:Zdbf2 UTSW 1 63,347,162 (GRCm39) missense probably benign 0.00
R9061:Zdbf2 UTSW 1 63,346,296 (GRCm39) missense
R9072:Zdbf2 UTSW 1 63,344,923 (GRCm39) missense possibly damaging 0.83
R9232:Zdbf2 UTSW 1 63,347,168 (GRCm39) missense possibly damaging 0.66
R9411:Zdbf2 UTSW 1 63,343,288 (GRCm39) missense probably damaging 0.97
R9470:Zdbf2 UTSW 1 63,344,784 (GRCm39) missense possibly damaging 0.82
R9606:Zdbf2 UTSW 1 63,342,536 (GRCm39) missense possibly damaging 0.92
R9621:Zdbf2 UTSW 1 63,342,635 (GRCm39) missense possibly damaging 0.66
RF021:Zdbf2 UTSW 1 63,341,811 (GRCm39) missense possibly damaging 0.82
X0018:Zdbf2 UTSW 1 63,344,510 (GRCm39) missense possibly damaging 0.92
X0027:Zdbf2 UTSW 1 63,347,166 (GRCm39) nonsense probably null
X0057:Zdbf2 UTSW 1 63,344,549 (GRCm39) missense possibly damaging 0.66
X0063:Zdbf2 UTSW 1 63,344,696 (GRCm39) missense probably benign 0.04
Z1176:Zdbf2 UTSW 1 63,343,404 (GRCm39) missense possibly damaging 0.83
Z1177:Zdbf2 UTSW 1 63,348,362 (GRCm39) missense unknown
Z1177:Zdbf2 UTSW 1 63,343,245 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TAGTTGAACCACCTGAACCTG -3'
(R):5'- TCAACAGGCTCTTGTGTTGC -3'

Sequencing Primer
(F):5'- GAACCTGAAGTAACTGTTTTGGAGCC -3'
(R):5'- TGCGTTAGTCACAGCCTGAAG -3'
Posted On 2022-03-25