Incidental Mutation 'R0747:B3gnt2'
ID70192
Institutional Source Beutler Lab
Gene Symbol B3gnt2
Ensembl Gene ENSMUSG00000051650
Gene NameUDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
SynonymsB3gnt1, B3Galt6
MMRRC Submission 038928-MU
Accession Numbers

Ncbi RefSeq: NM_016888.5, NM_001169114.1; MGI: 1889505

Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R0747 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location22759738-22860961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22836316 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 291 (I291V)
Ref Sequence ENSEMBL: ENSMUSP00000060247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055549] [ENSMUST00000062844] [ENSMUST00000160826] [ENSMUST00000173660]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055549
AA Change: I291V

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053528
Gene: ENSMUSG00000051650
AA Change: I291V

DomainStartEndE-ValueType
Pfam:Galactosyl_T 156 351 2.9e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000062844
AA Change: I291V

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000060247
Gene: ENSMUSG00000051650
AA Change: I291V

DomainStartEndE-ValueType
Pfam:Galactosyl_T 156 351 2.9e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160826
SMART Domains Protein: ENSMUSP00000125609
Gene: ENSMUSG00000098650

DomainStartEndE-ValueType
Pfam:HCaRG 1 99 1.3e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189990
Meta Mutation Damage Score 0.1135 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
MGI Phenotype Strain: 3576265; 3529146; 3604461
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase family. This enzyme is a type II transmembrane protein. It prefers the substrate of lacto-N-neotetraose, and is involved in the biosynthesis of poly-N-acetyllactosamine chains. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for a gene trap allele show severe axon guidance errors and specific loss of olfactory sensory neurons and glomeruli. Homozygotes for another gene trap allele show hyperactive lymphocytes and macrophages. Homozygotes for a reporter allele display behavioral despair and reduced anxiety. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(3) Gene trapped(2)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830406C13Rik T A 14: 12,287,287 M16K probably benign Het
Adam19 A T 11: 46,118,495 probably null Het
Anks4b C T 7: 120,182,163 A139V probably damaging Het
Arf1 G A 11: 59,212,635 R149C probably benign Het
Axl A T 7: 25,764,059 C598S possibly damaging Het
Ccdc158 T A 5: 92,633,297 H883L probably benign Het
Col6a3 A G 1: 90,802,653 S1644P probably damaging Het
Cspg4 T C 9: 56,890,280 S1343P probably damaging Het
D430041D05Rik G T 2: 104,230,306 H1414Q probably damaging Het
Dnah5 C G 15: 28,444,186 I4043M probably damaging Het
Dnah5 T A 15: 28,444,187 C4044S possibly damaging Het
Dpep3 C T 8: 105,977,386 A267T probably benign Het
Dync1h1 A C 12: 110,612,411 H106P probably benign Het
Dync1h1 A C 12: 110,629,284 E1466A probably damaging Het
Fggy T C 4: 95,812,100 probably benign Het
Frmd6 A G 12: 70,864,056 T5A probably benign Het
Gnb5 G A 9: 75,311,470 V26I probably benign Het
Hephl1 A T 9: 15,054,001 probably benign Het
Hmmr C T 11: 40,721,745 probably benign Het
Hpn A T 7: 31,099,546 F356Y probably damaging Het
Iqgap3 T C 3: 88,107,503 probably benign Het
Ism2 A G 12: 87,285,398 probably benign Het
Kansl1 T A 11: 104,342,976 M754L probably benign Het
Kcnc4 A T 3: 107,448,154 I326N probably damaging Het
Lcn6 G A 2: 25,677,172 V62M probably damaging Het
Lrp1b A T 2: 40,870,341 C2858S probably damaging Het
Lyn G A 4: 3,745,638 probably benign Het
Mov10 T A 3: 104,802,496 H358L probably benign Het
Notch1 A G 2: 26,472,140 V60A unknown Het
Olfr720 C T 14: 14,175,429 A218T probably benign Het
Pgap2 C A 7: 102,237,136 Y176* probably null Het
Pglyrp1 A G 7: 18,890,275 Q161R possibly damaging Het
Plod3 A G 5: 136,988,195 N66S probably benign Het
Psmc3 A G 2: 91,054,300 E18G probably benign Het
Psme3 T G 11: 101,317,046 M9R probably benign Het
Rapgef4 A G 2: 72,223,073 N428S possibly damaging Het
Rbp3 A G 14: 33,956,278 I728V possibly damaging Het
Sall4 A T 2: 168,754,966 H651Q probably damaging Het
Skint3 T A 4: 112,253,905 Y76N probably damaging Het
Slc13a4 T C 6: 35,278,328 T342A probably damaging Het
Slc25a1 G T 16: 17,926,220 T239K probably damaging Het
Slc36a2 T A 11: 55,169,859 I242F probably benign Het
Tekt2 G A 4: 126,323,760 Q171* probably null Het
Tet2 T G 3: 133,467,470 H1677P possibly damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trcg1 C T 9: 57,241,921 P259S probably benign Het
Ttn A C 2: 76,710,598 S25688A probably damaging Het
Vmn2r117 T A 17: 23,475,503 R457* probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Other mutations in B3gnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:B3gnt2 APN 11 22836151 missense probably benign 0.34
IGL01061:B3gnt2 APN 11 22836042 missense probably damaging 1.00
IGL01123:B3gnt2 APN 11 22836490 missense probably benign 0.01
IGL01455:B3gnt2 APN 11 22837042 missense probably damaging 1.00
R0094:B3gnt2 UTSW 11 22836655 missense probably damaging 0.99
R0309:B3gnt2 UTSW 11 22836860 missense probably damaging 0.98
R1163:B3gnt2 UTSW 11 22836558 missense probably benign 0.02
R2016:B3gnt2 UTSW 11 22836621 missense probably damaging 1.00
R2017:B3gnt2 UTSW 11 22836621 missense probably damaging 1.00
R2066:B3gnt2 UTSW 11 22836735 missense probably damaging 1.00
R2090:B3gnt2 UTSW 11 22836291 missense probably benign 0.00
R3768:B3gnt2 UTSW 11 22836765 missense probably damaging 0.98
R4604:B3gnt2 UTSW 11 22836426 frame shift probably null
R4680:B3gnt2 UTSW 11 22837105 missense probably damaging 1.00
R5623:B3gnt2 UTSW 11 22837018 missense probably damaging 0.97
R6589:B3gnt2 UTSW 11 22837117 missense probably damaging 1.00
R6731:B3gnt2 UTSW 11 22836888 nonsense probably null
R7391:B3gnt2 UTSW 11 22836482 nonsense probably null
R7970:B3gnt2 UTSW 11 22836255 missense probably damaging 1.00
R8183:B3gnt2 UTSW 11 22836373 missense probably benign 0.19
R8801:B3gnt2 UTSW 11 22837002 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCCAGTTTCTGAAGGCACATTCCC -3'
(R):5'- TTTGAGAGTGACAAGCACCAGGAC -3'

Sequencing Primer
(F):5'- TGAAGGCACATTCCCGTATAAAC -3'
(R):5'- CAACCTGTCCCTGAAGGAAGTG -3'
Posted On2013-09-30