Incidental Mutation 'R0747:Arf1'
ID70196
Institutional Source Beutler Lab
Gene Symbol Arf1
Ensembl Gene ENSMUSG00000048076
Gene NameADP-ribosylation factor 1
Synonyms
MMRRC Submission 038928-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0747 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location59211412-59228270 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59212635 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 149 (R149C)
Ref Sequence ENSEMBL: ENSMUSP00000126120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020719] [ENSMUST00000061242] [ENSMUST00000163300]
Predicted Effect probably benign
Transcript: ENSMUST00000020719
SMART Domains Protein: ENSMUSP00000020719
Gene: ENSMUSG00000020441

DomainStartEndE-ValueType
Pfam:MMtag 8 83 5.7e-34 PFAM
low complexity region 117 135 N/A INTRINSIC
low complexity region 180 208 N/A INTRINSIC
low complexity region 215 224 N/A INTRINSIC
low complexity region 250 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061242
AA Change: R149C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079905
Gene: ENSMUSG00000048076
AA Change: R149C

DomainStartEndE-ValueType
ARF 1 181 2.34e-143 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101158
Predicted Effect probably benign
Transcript: ENSMUST00000163300
AA Change: R149C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126120
Gene: ENSMUSG00000048076
AA Change: R149C

DomainStartEndE-ValueType
ARF 1 181 2.34e-143 SMART
Meta Mutation Damage Score 0.1072 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factor 1 (ARF1) is a member of the human ARF gene family. The family members encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking as activators of phospholipase D. The gene products, including 6 ARF proteins and 11 ARF-like proteins, constitute a family of the RAS superfamily. The ARF proteins are categorized as class I (ARF1, ARF2 and ARF3), class II (ARF4 and ARF5) and class III (ARF6), and members of each class share a common gene organization. The ARF1 protein is localized to the Golgi apparatus and has a central role in intra-Golgi transport. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die in utero shortly after implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830406C13Rik T A 14: 12,287,287 M16K probably benign Het
Adam19 A T 11: 46,118,495 probably null Het
Anks4b C T 7: 120,182,163 A139V probably damaging Het
Axl A T 7: 25,764,059 C598S possibly damaging Het
B3gnt2 T C 11: 22,836,316 I291V possibly damaging Het
Ccdc158 T A 5: 92,633,297 H883L probably benign Het
Col6a3 A G 1: 90,802,653 S1644P probably damaging Het
Cspg4 T C 9: 56,890,280 S1343P probably damaging Het
D430041D05Rik G T 2: 104,230,306 H1414Q probably damaging Het
Dnah5 C G 15: 28,444,186 I4043M probably damaging Het
Dnah5 T A 15: 28,444,187 C4044S possibly damaging Het
Dpep3 C T 8: 105,977,386 A267T probably benign Het
Dync1h1 A C 12: 110,612,411 H106P probably benign Het
Dync1h1 A C 12: 110,629,284 E1466A probably damaging Het
Fggy T C 4: 95,812,100 probably benign Het
Frmd6 A G 12: 70,864,056 T5A probably benign Het
Gnb5 G A 9: 75,311,470 V26I probably benign Het
Hephl1 A T 9: 15,054,001 probably benign Het
Hmmr C T 11: 40,721,745 probably benign Het
Hpn A T 7: 31,099,546 F356Y probably damaging Het
Iqgap3 T C 3: 88,107,503 probably benign Het
Ism2 A G 12: 87,285,398 probably benign Het
Kansl1 T A 11: 104,342,976 M754L probably benign Het
Kcnc4 A T 3: 107,448,154 I326N probably damaging Het
Lcn6 G A 2: 25,677,172 V62M probably damaging Het
Lrp1b A T 2: 40,870,341 C2858S probably damaging Het
Lyn G A 4: 3,745,638 probably benign Het
Mov10 T A 3: 104,802,496 H358L probably benign Het
Notch1 A G 2: 26,472,140 V60A unknown Het
Olfr720 C T 14: 14,175,429 A218T probably benign Het
Pgap2 C A 7: 102,237,136 Y176* probably null Het
Pglyrp1 A G 7: 18,890,275 Q161R possibly damaging Het
Plod3 A G 5: 136,988,195 N66S probably benign Het
Psmc3 A G 2: 91,054,300 E18G probably benign Het
Psme3 T G 11: 101,317,046 M9R probably benign Het
Rapgef4 A G 2: 72,223,073 N428S possibly damaging Het
Rbp3 A G 14: 33,956,278 I728V possibly damaging Het
Sall4 A T 2: 168,754,966 H651Q probably damaging Het
Skint3 T A 4: 112,253,905 Y76N probably damaging Het
Slc13a4 T C 6: 35,278,328 T342A probably damaging Het
Slc25a1 G T 16: 17,926,220 T239K probably damaging Het
Slc36a2 T A 11: 55,169,859 I242F probably benign Het
Tekt2 G A 4: 126,323,760 Q171* probably null Het
Tet2 T G 3: 133,467,470 H1677P possibly damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trcg1 C T 9: 57,241,921 P259S probably benign Het
Ttn A C 2: 76,710,598 S25688A probably damaging Het
Vmn2r117 T A 17: 23,475,503 R457* probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Other mutations in Arf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02250:Arf1 APN 11 59213167 missense probably benign 0.00
IGL03268:Arf1 APN 11 59212837 missense possibly damaging 0.49
R5338:Arf1 UTSW 11 59213215 missense probably damaging 1.00
R6633:Arf1 UTSW 11 59212544 missense probably benign
X0028:Arf1 UTSW 11 59212835 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- GCACGTTTGCCACATGAGAGGAAAG -3'
(R):5'- CCATTTCAGGGCATGAAGCCACAC -3'

Sequencing Primer
(F):5'- CCACATGAGAGGAAAGCTGAG -3'
(R):5'- TCTTCGTAGTGGACAGCAATGAC -3'
Posted On2013-09-30