Incidental Mutation 'R9257:Rhbdf1'
ID 701960
Institutional Source Beutler Lab
Gene Symbol Rhbdf1
Ensembl Gene ENSMUSG00000020282
Gene Name rhomboid 5 homolog 1
Synonyms Dist, Dist1, Egfr-rs
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock # R9257 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 32209585-32222300 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 32210754 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 634 (H634R)
Ref Sequence ENSEMBL: ENSMUSP00000020524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020524] [ENSMUST00000039601] [ENSMUST00000121182] [ENSMUST00000132578] [ENSMUST00000143988] [ENSMUST00000146179] [ENSMUST00000149043] [ENSMUST00000150381]
AlphaFold Q6PIX5
Predicted Effect probably benign
Transcript: ENSMUST00000020524
AA Change: H634R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000020524
Gene: ENSMUSG00000020282
AA Change: H634R

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 308 1.6e-116 PFAM
Pfam:Rhomboid 648 792 2.1e-32 PFAM
transmembrane domain 805 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039601
SMART Domains Protein: ENSMUSP00000046654
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 123 4e-63 PDB
Blast:UBQ 32 119 1e-30 BLAST
SCOP:d1euvb_ 32 121 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121182
SMART Domains Protein: ENSMUSP00000112483
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 83 4e-28 PDB
Blast:UBQ 32 83 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132578
SMART Domains Protein: ENSMUSP00000120543
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 158 7.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143988
AA Change: H37R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117471
Gene: ENSMUSG00000020282
AA Change: H37R

DomainStartEndE-ValueType
Pfam:Rhomboid 52 167 1.6e-24 PFAM
transmembrane domain 181 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146179
SMART Domains Protein: ENSMUSP00000118985
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 155 7.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149043
SMART Domains Protein: ENSMUSP00000119306
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 96 1e-40 PDB
Blast:UBQ 32 96 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150381
SMART Domains Protein: ENSMUSP00000118769
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show pleiotropic phenotypes and postnatal lethality largely dependent on the genetic background. Observed defects range from small size, reduced fat mass, and brain haemorrhages to small lymph organs, thrombosis, abnormal pancreatic acini, and behavioral deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T A 2: 151,473,707 D17V probably benign Het
4933415F23Rik G T 1: 23,102,194 T13N probably benign Het
9130401M01Rik A C 15: 58,029,018 H128Q possibly damaging Het
Abcd2 T C 15: 91,191,112 Y166C possibly damaging Het
Adamtsl4 C A 3: 95,681,265 V546F probably damaging Het
AI464131 T C 4: 41,499,030 D200G probably benign Het
Als2cl T A 9: 110,894,687 V717E probably damaging Het
Atm A G 9: 53,495,850 probably null Het
Atp2c1 C A 9: 105,414,652 E904* probably null Het
Ccdc88c G A 12: 100,923,215 S1523F possibly damaging Het
Cds1 A T 5: 101,815,885 I357F probably benign Het
Cilp T A 9: 65,267,169 V13D possibly damaging Het
Copz2 A G 11: 96,857,560 D180G possibly damaging Het
Cpsf1 C T 15: 76,600,792 E546K probably benign Het
Ctsm T C 13: 61,536,599 N320D probably damaging Het
Fat3 G A 9: 15,996,567 T2713I probably benign Het
Fcrl5 T A 3: 87,435,888 S2T probably benign Het
Fgfr4 T C 13: 55,168,161 S796P unknown Het
Flrt3 A G 2: 140,660,239 F490L probably benign Het
Fras1 A T 5: 96,762,500 I3263F probably damaging Het
Gm13089 T A 4: 143,699,115 D86V probably damaging Het
Hydin A T 8: 110,575,016 D3793V probably damaging Het
Kif5c T A 2: 49,700,592 L269* probably null Het
Klhl32 A G 4: 24,649,608 V396A probably benign Het
Krt2 C T 15: 101,816,491 R228Q probably benign Het
Lcn9 T C 2: 25,824,772 probably null Het
Lingo4 A C 3: 94,403,369 D538A probably benign Het
Lonp1 G T 17: 56,620,516 Y299* probably null Het
Mettl16 T A 11: 74,817,301 V442D possibly damaging Het
Mis18bp1 A G 12: 65,133,857 V950A probably benign Het
Mndal A T 1: 173,862,708 V352E probably damaging Het
Mrpl55 T C 11: 59,205,752 V117A probably benign Het
Muc6 T A 7: 141,640,471 S1430C unknown Het
Myh11 C A 16: 14,269,256 G119C Het
Neu1 A G 17: 34,931,420 D5G probably benign Het
Nrcam T A 12: 44,564,054 D512E probably benign Het
Nup214 T G 2: 32,033,335 V1292G possibly damaging Het
Nwd1 T A 8: 72,670,938 L602M probably damaging Het
Olfr803 C A 10: 129,691,134 L302F probably benign Het
Pck2 G T 14: 55,545,245 G379W probably damaging Het
Per2 C T 1: 91,448,723 V143M probably damaging Het
Pfkl A T 10: 77,989,655 Y634N probably damaging Het
Phlpp1 A G 1: 106,172,551 D183G possibly damaging Het
Pkdrej T A 15: 85,815,897 Y1946F probably damaging Het
Plxna4 C T 6: 32,162,083 D1717N probably damaging Het
Prdm16 A T 4: 154,337,698 V879E probably damaging Het
Prr23a3 T C 9: 98,865,245 V84A probably benign Het
Ptp4a1 A G 1: 30,946,265 probably benign Het
Rmi2 T C 16: 10,835,225 S46P probably benign Het
Rrnad1 G T 3: 87,924,461 Q397K probably benign Het
Rsf1 A T 7: 97,685,711 E1350D Het
Slc6a6 T A 6: 91,739,971 F276Y possibly damaging Het
Sppl3 A G 5: 115,083,473 Y120C probably benign Het
Stard13 G T 5: 151,062,491 A518E probably benign Het
Taf2 A T 15: 55,066,013 V49E possibly damaging Het
Tas2r137 T A 6: 40,491,658 W141R probably damaging Het
Tlx2 T A 6: 83,070,054 H9L unknown Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tmem132d G A 5: 127,784,427 Q877* probably null Het
Unc5d A T 8: 28,725,146 probably null Het
Upp1 A T 11: 9,125,661 T4S probably benign Het
Uros A T 7: 133,691,124 I146N probably damaging Het
Vsig10 A T 5: 117,325,066 D119V probably benign Het
Washc2 C A 6: 116,216,108 Y138* probably null Het
Ywhah T A 5: 33,026,751 D99E probably benign Het
Zdbf2 G A 1: 63,306,241 G1260R probably damaging Het
Zfp663 T C 2: 165,354,054 T82A probably benign Het
Zfp831 T A 2: 174,646,363 C944S possibly damaging Het
Other mutations in Rhbdf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01863:Rhbdf1 APN 11 32213484 missense probably benign
IGL02183:Rhbdf1 APN 11 32210543 missense probably damaging 1.00
IGL02793:Rhbdf1 APN 11 32213293 missense possibly damaging 0.92
IGL02875:Rhbdf1 APN 11 32213293 missense possibly damaging 0.92
BB005:Rhbdf1 UTSW 11 32209898 missense possibly damaging 0.93
BB015:Rhbdf1 UTSW 11 32209898 missense possibly damaging 0.93
FR4589:Rhbdf1 UTSW 11 32214391 unclassified probably benign
R0071:Rhbdf1 UTSW 11 32210498 missense probably damaging 1.00
R0180:Rhbdf1 UTSW 11 32210042 missense possibly damaging 0.76
R0512:Rhbdf1 UTSW 11 32210875 nonsense probably null
R0843:Rhbdf1 UTSW 11 32215053 missense probably damaging 1.00
R0880:Rhbdf1 UTSW 11 32213432 splice site probably null
R1952:Rhbdf1 UTSW 11 32214277 nonsense probably null
R2017:Rhbdf1 UTSW 11 32210471 missense probably damaging 1.00
R2076:Rhbdf1 UTSW 11 32214088 missense probably benign 0.01
R3032:Rhbdf1 UTSW 11 32209985 missense probably damaging 1.00
R4355:Rhbdf1 UTSW 11 32216236 missense probably damaging 1.00
R4429:Rhbdf1 UTSW 11 32213369 missense probably benign 0.00
R4865:Rhbdf1 UTSW 11 32214517 missense probably damaging 1.00
R5585:Rhbdf1 UTSW 11 32210222 splice site probably null
R5728:Rhbdf1 UTSW 11 32209901 splice site probably null
R5925:Rhbdf1 UTSW 11 32212906 missense probably benign 0.24
R5940:Rhbdf1 UTSW 11 32209847 missense probably benign 0.00
R6083:Rhbdf1 UTSW 11 32210066 missense probably damaging 1.00
R6088:Rhbdf1 UTSW 11 32212007 missense possibly damaging 0.62
R6361:Rhbdf1 UTSW 11 32212915 missense possibly damaging 0.92
R6692:Rhbdf1 UTSW 11 32215652 missense probably damaging 0.98
R6727:Rhbdf1 UTSW 11 32214042 missense possibly damaging 0.78
R6825:Rhbdf1 UTSW 11 32209970 missense probably damaging 1.00
R7589:Rhbdf1 UTSW 11 32212903 missense probably benign 0.01
R7928:Rhbdf1 UTSW 11 32209898 missense possibly damaging 0.93
R7940:Rhbdf1 UTSW 11 32216258 start codon destroyed possibly damaging 0.79
R7957:Rhbdf1 UTSW 11 32210523 missense probably damaging 1.00
R8220:Rhbdf1 UTSW 11 32214563 missense probably benign 0.30
R8490:Rhbdf1 UTSW 11 32210162 missense probably damaging 0.98
R8939:Rhbdf1 UTSW 11 32210093 missense probably benign 0.00
R9040:Rhbdf1 UTSW 11 32213063 missense probably benign 0.23
R9509:Rhbdf1 UTSW 11 32215055 missense possibly damaging 0.96
R9575:Rhbdf1 UTSW 11 32213101 missense not run
V3553:Rhbdf1 UTSW 11 32211583 missense probably damaging 1.00
Z1176:Rhbdf1 UTSW 11 32215125 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AAGGGAGCTTCTCTTTTGCC -3'
(R):5'- AGAGCACAGGTGACTATAGATCTC -3'

Sequencing Primer
(F):5'- GGAGCTTCTCTTTTGCCTCCAG -3'
(R):5'- GGTGACTATAGATCTCAGCAGCCTC -3'
Posted On 2022-03-25