Incidental Mutation 'R9257:Krt2'
ID 701975
Institutional Source Beutler Lab
Gene Symbol Krt2
Ensembl Gene ENSMUSG00000064201
Gene Name keratin 2
Synonyms Krt2-17, Krt2-2, Krt2e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock # R9257 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 101810689-101818169 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 101816491 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 228 (R228Q)
Ref Sequence ENSEMBL: ENSMUSP00000023712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023712]
AlphaFold Q3TTY5
Predicted Effect probably benign
Transcript: ENSMUST00000023712
AA Change: R228Q

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000023712
Gene: ENSMUSG00000064201
AA Change: R228Q

DomainStartEndE-ValueType
Pfam:Keratin_2_head 23 195 3.6e-26 PFAM
Filament 198 511 4.22e-152 SMART
low complexity region 520 533 N/A INTRINSIC
low complexity region 538 701 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: ENU-induced mutant mice exhibit scaly skin and increased pigmentation in the tail, ears and feet. Mice homozygous for a knock-out allele show scaly skin, acanthosis, hyperkeratosis, increased water loss, ear skin inflammation, and aberrant aggregation of keratin 10 in suprabasal epidermal keratinocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T A 2: 151,473,707 D17V probably benign Het
4933415F23Rik G T 1: 23,102,194 T13N probably benign Het
9130401M01Rik A C 15: 58,029,018 H128Q possibly damaging Het
Abcd2 T C 15: 91,191,112 Y166C possibly damaging Het
Adamtsl4 C A 3: 95,681,265 V546F probably damaging Het
AI464131 T C 4: 41,499,030 D200G probably benign Het
Als2cl T A 9: 110,894,687 V717E probably damaging Het
Atm A G 9: 53,495,850 probably null Het
Atp2c1 C A 9: 105,414,652 E904* probably null Het
Ccdc88c G A 12: 100,923,215 S1523F possibly damaging Het
Cds1 A T 5: 101,815,885 I357F probably benign Het
Cilp T A 9: 65,267,169 V13D possibly damaging Het
Copz2 A G 11: 96,857,560 D180G possibly damaging Het
Cpsf1 C T 15: 76,600,792 E546K probably benign Het
Ctsm T C 13: 61,536,599 N320D probably damaging Het
Fat3 G A 9: 15,996,567 T2713I probably benign Het
Fcrl5 T A 3: 87,435,888 S2T probably benign Het
Fgfr4 T C 13: 55,168,161 S796P unknown Het
Flrt3 A G 2: 140,660,239 F490L probably benign Het
Fras1 A T 5: 96,762,500 I3263F probably damaging Het
Gm13089 T A 4: 143,699,115 D86V probably damaging Het
Hydin A T 8: 110,575,016 D3793V probably damaging Het
Kif5c T A 2: 49,700,592 L269* probably null Het
Klhl32 A G 4: 24,649,608 V396A probably benign Het
Lcn9 T C 2: 25,824,772 probably null Het
Lingo4 A C 3: 94,403,369 D538A probably benign Het
Lonp1 G T 17: 56,620,516 Y299* probably null Het
Mettl16 T A 11: 74,817,301 V442D possibly damaging Het
Mis18bp1 A G 12: 65,133,857 V950A probably benign Het
Mndal A T 1: 173,862,708 V352E probably damaging Het
Mrpl55 T C 11: 59,205,752 V117A probably benign Het
Muc6 T A 7: 141,640,471 S1430C unknown Het
Myh11 C A 16: 14,269,256 G119C Het
Neu1 A G 17: 34,931,420 D5G probably benign Het
Nrcam T A 12: 44,564,054 D512E probably benign Het
Nup214 T G 2: 32,033,335 V1292G possibly damaging Het
Nwd1 T A 8: 72,670,938 L602M probably damaging Het
Olfr803 C A 10: 129,691,134 L302F probably benign Het
Pck2 G T 14: 55,545,245 G379W probably damaging Het
Per2 C T 1: 91,448,723 V143M probably damaging Het
Pfkl A T 10: 77,989,655 Y634N probably damaging Het
Phlpp1 A G 1: 106,172,551 D183G possibly damaging Het
Pkdrej T A 15: 85,815,897 Y1946F probably damaging Het
Plxna4 C T 6: 32,162,083 D1717N probably damaging Het
Prdm16 A T 4: 154,337,698 V879E probably damaging Het
Prr23a3 T C 9: 98,865,245 V84A probably benign Het
Ptp4a1 A G 1: 30,946,265 probably benign Het
Rhbdf1 T C 11: 32,210,754 H634R probably benign Het
Rmi2 T C 16: 10,835,225 S46P probably benign Het
Rrnad1 G T 3: 87,924,461 Q397K probably benign Het
Rsf1 A T 7: 97,685,711 E1350D Het
Slc6a6 T A 6: 91,739,971 F276Y possibly damaging Het
Sppl3 A G 5: 115,083,473 Y120C probably benign Het
Stard13 G T 5: 151,062,491 A518E probably benign Het
Taf2 A T 15: 55,066,013 V49E possibly damaging Het
Tas2r137 T A 6: 40,491,658 W141R probably damaging Het
Tlx2 T A 6: 83,070,054 H9L unknown Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tmem132d G A 5: 127,784,427 Q877* probably null Het
Unc5d A T 8: 28,725,146 probably null Het
Upp1 A T 11: 9,125,661 T4S probably benign Het
Uros A T 7: 133,691,124 I146N probably damaging Het
Vsig10 A T 5: 117,325,066 D119V probably benign Het
Washc2 C A 6: 116,216,108 Y138* probably null Het
Ywhah T A 5: 33,026,751 D99E probably benign Het
Zdbf2 G A 1: 63,306,241 G1260R probably damaging Het
Zfp663 T C 2: 165,354,054 T82A probably benign Het
Zfp831 T A 2: 174,646,363 C944S possibly damaging Het
Other mutations in Krt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Krt2 APN 15 101811211 missense probably benign 0.23
IGL01568:Krt2 APN 15 101813211 missense probably damaging 1.00
IGL01586:Krt2 APN 15 101811390 missense unknown
IGL01667:Krt2 APN 15 101816330 missense possibly damaging 0.85
IGL02017:Krt2 APN 15 101816504 missense probably damaging 1.00
IGL02022:Krt2 APN 15 101816518 missense probably damaging 1.00
IGL02538:Krt2 APN 15 101811154 missense unknown
IGL02959:Krt2 APN 15 101811328 missense unknown
IGL03295:Krt2 APN 15 101816429 missense probably damaging 0.99
R0195:Krt2 UTSW 15 101813191 nonsense probably null
R0472:Krt2 UTSW 15 101813253 missense probably damaging 1.00
R0749:Krt2 UTSW 15 101817663 missense unknown
R0785:Krt2 UTSW 15 101817921 missense unknown
R0792:Krt2 UTSW 15 101816497 missense probably damaging 1.00
R1232:Krt2 UTSW 15 101811784 missense probably damaging 1.00
R1281:Krt2 UTSW 15 101813292 missense probably damaging 1.00
R1770:Krt2 UTSW 15 101811154 missense unknown
R1783:Krt2 UTSW 15 101813973 missense probably damaging 1.00
R1795:Krt2 UTSW 15 101816426 missense possibly damaging 0.85
R2283:Krt2 UTSW 15 101814387 missense probably damaging 1.00
R3977:Krt2 UTSW 15 101811127 missense unknown
R4575:Krt2 UTSW 15 101814486 missense probably damaging 1.00
R4619:Krt2 UTSW 15 101817591 missense probably damaging 1.00
R4620:Krt2 UTSW 15 101817591 missense probably damaging 1.00
R4766:Krt2 UTSW 15 101813960 missense probably damaging 1.00
R4819:Krt2 UTSW 15 101811544 missense unknown
R4953:Krt2 UTSW 15 101813942 missense probably damaging 1.00
R5108:Krt2 UTSW 15 101813286 missense possibly damaging 0.88
R5973:Krt2 UTSW 15 101816312 missense probably damaging 0.99
R6122:Krt2 UTSW 15 101815914 missense probably damaging 1.00
R6180:Krt2 UTSW 15 101815044 missense probably benign 0.05
R6661:Krt2 UTSW 15 101815963 missense probably damaging 1.00
R6974:Krt2 UTSW 15 101817879 missense unknown
R6993:Krt2 UTSW 15 101815960 missense probably damaging 1.00
R7104:Krt2 UTSW 15 101815087 missense probably benign 0.09
R7573:Krt2 UTSW 15 101814519 missense probably benign 0.05
R7947:Krt2 UTSW 15 101816334 missense probably damaging 1.00
R8469:Krt2 UTSW 15 101816369 missense probably benign 0.22
R8805:Krt2 UTSW 15 101815944 missense possibly damaging 0.93
R9051:Krt2 UTSW 15 101817882 missense unknown
R9118:Krt2 UTSW 15 101814541 missense probably damaging 0.99
R9230:Krt2 UTSW 15 101817513 missense probably benign 0.39
R9424:Krt2 UTSW 15 101811357 missense unknown
R9569:Krt2 UTSW 15 101816489 missense probably damaging 1.00
R9576:Krt2 UTSW 15 101811357 missense unknown
RF020:Krt2 UTSW 15 101817968 missense unknown
Z1177:Krt2 UTSW 15 101811550 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGTCTTCCACGAGATCCTGC -3'
(R):5'- GTCTATAGAACTTCCATGTGTGATG -3'

Sequencing Primer
(F):5'- CACGAGATCCTGCATGTTGTTCAG -3'
(R):5'- TCAGAAGCTCTGCCTGGTG -3'
Posted On 2022-03-25