Incidental Mutation 'R9258:Aox2'
ID 701981
Institutional Source Beutler Lab
Gene Symbol Aox2
Ensembl Gene ENSMUSG00000079554
Gene Name aldehyde oxidase 2
Synonyms Aox3l1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R9258 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 58278326-58380259 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 58312356 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 701 (I701F)
Ref Sequence ENSEMBL: ENSMUSP00000110006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114366]
AlphaFold Q5SGK3
Predicted Effect probably damaging
Transcript: ENSMUST00000114366
AA Change: I701F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554
AA Change: I701F

DomainStartEndE-ValueType
Pfam:Fer2 13 83 3.4e-9 PFAM
Pfam:Fer2_2 92 166 4.2e-30 PFAM
Pfam:FAD_binding_5 241 421 5.1e-46 PFAM
CO_deh_flav_C 428 532 1.4e-23 SMART
Ald_Xan_dh_C 604 707 4.64e-47 SMART
Pfam:Ald_Xan_dh_C2 717 1251 1.3e-178 PFAM
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik A G 8: 105,282,143 V414A probably damaging Het
Abcb10 T A 8: 123,982,608 Q69L probably benign Het
Abtb2 A C 2: 103,716,065 Q930P probably null Het
Adam18 G A 8: 24,668,558 T73I probably benign Het
Ankrd54 A T 15: 79,062,796 M1K probably null Het
Anks1 T C 17: 28,058,426 V1106A probably damaging Het
Arfgef3 C T 10: 18,589,639 R2152H probably damaging Het
Arnt2 C T 7: 84,361,590 G37E probably damaging Het
Arpp21 G A 9: 112,124,888 T581M probably benign Het
Arvcf A G 16: 18,398,207 N428S probably damaging Het
C2cd3 A G 7: 100,448,819 E1471G Het
Cadm1 A G 9: 47,799,432 K211R probably benign Het
Cdh6 A G 15: 13,064,376 S143P probably damaging Het
Cep152 G A 2: 125,579,436 Q1125* probably null Het
Cfap54 A C 10: 92,935,098 S2095A unknown Het
Col12a1 T C 9: 79,706,363 T67A probably benign Het
Col6a3 T C 1: 90,772,981 N3216S unknown Het
Cpeb2 T A 5: 43,234,112 L217Q Het
Ctbp2 A T 7: 132,995,292 N119K probably damaging Het
Des G T 1: 75,363,645 V399L probably benign Het
Dnah2 G T 11: 69,477,253 H1753Q probably damaging Het
Dnajc6 T C 4: 101,618,616 V562A probably benign Het
Dusp13 T C 14: 21,741,087 D99G probably benign Het
Ehd3 A G 17: 73,820,566 I165V probably benign Het
Eme2 C T 17: 24,893,079 V241M probably damaging Het
Eml5 A G 12: 98,844,117 L860P possibly damaging Het
Eogt T A 6: 97,112,082 K521M possibly damaging Het
Epb41l5 T C 1: 119,578,971 T489A probably benign Het
Fmo5 G T 3: 97,651,486 V421L probably benign Het
Gabpa C T 16: 84,856,515 P268S probably benign Het
Gas2l3 G T 10: 89,426,453 H136N probably benign Het
Gm5592 C T 7: 41,288,983 A563V possibly damaging Het
Gpn3 A T 5: 122,381,445 D205V probably benign Het
H13 T C 2: 152,681,079 L104S probably damaging Het
H2-Q4 T A 17: 35,380,129 V125E probably benign Het
Ifih1 A G 2: 62,611,898 F374S probably damaging Het
Ildr2 A G 1: 166,303,589 D338G probably damaging Het
Kmt2b A T 7: 30,582,468 N1162K probably null Het
Lmntd1 T C 6: 145,413,530 D298G probably damaging Het
Lrrc32 T A 7: 98,499,138 V375E probably benign Het
Lrrc37a A C 11: 103,502,196 I801R probably benign Het
Mgam A G 6: 40,680,187 E935G probably benign Het
Mms22l A T 4: 24,588,238 T917S probably damaging Het
Myo3a A T 2: 22,577,533 E1204D possibly damaging Het
Nav3 T A 10: 109,714,382 E1829V probably damaging Het
Nccrp1 C T 7: 28,546,207 G150D probably damaging Het
Nlrp4b G T 7: 10,710,160 W12L probably damaging Het
Nmb T C 7: 80,904,253 T71A possibly damaging Het
Ogfod2 T A 5: 124,112,442 H35Q probably benign Het
Ola1 A T 2: 73,099,388 S290R probably damaging Het
Olfr1297 A T 2: 111,621,984 I30N possibly damaging Het
Olfr1499 A T 19: 13,814,735 L285* probably null Het
Olfr390 T G 11: 73,787,455 N172K probably benign Het
Olfr493 T G 7: 108,346,679 T101P probably benign Het
Olfr589 C A 7: 103,155,202 E182* probably null Het
Olfr621-ps1 T G 7: 103,629,336 Y208S unknown Het
Pcsk9 T C 4: 106,458,850 D132G possibly damaging Het
Pkhd1 A T 1: 20,373,950 V2296E probably damaging Het
Prl2c5 A T 13: 13,190,712 I151L probably damaging Het
Prl3d3 A T 13: 27,160,948 D101V possibly damaging Het
Prrt1 A G 17: 34,631,146 Y178C probably damaging Het
Rasal1 A T 5: 120,655,090 I87F possibly damaging Het
Rpgrip1l A T 8: 91,260,986 Y814* probably null Het
Rpl3l T G 17: 24,732,473 probably null Het
Rrbp1 C A 2: 144,011,241 probably benign Het
Ryr3 A G 2: 112,653,019 S4158P probably damaging Het
Scube2 G T 7: 109,799,308 S951Y probably damaging Het
Sec14l1 T C 11: 117,150,176 V396A probably benign Het
Sh3gl1 T A 17: 56,018,911 K173* probably null Het
Shank3 A T 15: 89,504,318 E371V probably damaging Het
Slc25a24 A G 3: 109,159,435 T302A probably damaging Het
Slc25a41 A T 17: 57,041,580 H4Q probably benign Het
Slc45a1 A T 4: 150,638,614 V271D possibly damaging Het
Smad6 A T 9: 64,020,291 L245Q probably damaging Het
Smad7 C A 18: 75,394,246 Q388K probably damaging Het
Snx29 G T 16: 11,714,935 D348Y possibly damaging Het
Son A T 16: 91,677,682 H2418L unknown Het
Sppl3 G A 5: 115,095,863 V331M probably damaging Het
St13 T G 15: 81,388,368 T92P probably benign Het
St3gal4 A G 9: 35,052,347 W222R probably damaging Het
Stk32a T A 18: 43,311,934 N264K probably benign Het
Stoml3 T A 3: 53,497,976 I26N possibly damaging Het
Taf7 T C 18: 37,642,968 E182G probably damaging Het
Tas2r138 A G 6: 40,613,195 V39A probably damaging Het
Tbc1d12 A G 19: 38,901,379 S418G possibly damaging Het
Tbr1 T A 2: 61,812,379 C663S probably benign Het
Tmc5 A T 7: 118,623,278 Y67F probably benign Het
Tnfsf4 A C 1: 161,417,243 I168L probably benign Het
Trav5-1 T G 14: 52,622,890 S51A probably benign Het
Trmt10c A T 16: 56,034,283 C330S possibly damaging Het
Trpm1 T C 7: 64,234,965 M798T probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Unc13d CATGCC CATGCCTCCGATGCC 11: 116,068,181 probably benign Het
Vmn1r199 A G 13: 22,382,652 T39A possibly damaging Het
Vmn1r74 T A 7: 11,847,072 C100S possibly damaging Het
Vmn2r77 T A 7: 86,803,094 I494K possibly damaging Het
Wdr17 G A 8: 54,659,619 Q816* probably null Het
Other mutations in Aox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Aox2 APN 1 58322801 missense possibly damaging 0.73
IGL01288:Aox2 APN 1 58294407 missense probably damaging 0.99
IGL01383:Aox2 APN 1 58294305 missense probably benign 0.09
IGL01734:Aox2 APN 1 58354310 missense possibly damaging 0.95
IGL01793:Aox2 APN 1 58336624 missense possibly damaging 0.79
IGL01834:Aox2 APN 1 58309024 missense possibly damaging 0.90
IGL01924:Aox2 APN 1 58287743 missense possibly damaging 0.90
IGL02591:Aox2 APN 1 58358999 nonsense probably null
IGL02645:Aox2 APN 1 58334724 missense probably damaging 1.00
IGL02710:Aox2 APN 1 58334769 critical splice donor site probably null
IGL02801:Aox2 APN 1 58354177 missense probably damaging 1.00
IGL02988:Aox2 APN 1 58337350 missense probably benign
IGL03104:Aox2 APN 1 58282759 missense probably benign
IGL03121:Aox2 APN 1 58358954 missense probably damaging 1.00
IGL03191:Aox2 APN 1 58359069 missense probably null 0.98
IGL03236:Aox2 APN 1 58309997 nonsense probably null
IGL03409:Aox2 APN 1 58354429 missense possibly damaging 0.91
PIT4362001:Aox2 UTSW 1 58282680 missense probably damaging 1.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0267:Aox2 UTSW 1 58339446 splice site probably benign
R0388:Aox2 UTSW 1 58354406 missense probably damaging 1.00
R0409:Aox2 UTSW 1 58336624 missense possibly damaging 0.90
R0547:Aox2 UTSW 1 58310042 missense probably damaging 0.96
R0630:Aox2 UTSW 1 58337321 splice site probably benign
R0726:Aox2 UTSW 1 58334782 splice site probably benign
R0734:Aox2 UTSW 1 58305341 missense probably benign 0.22
R0831:Aox2 UTSW 1 58339683 missense probably benign 0.28
R0961:Aox2 UTSW 1 58310071 missense probably benign 0.00
R1404:Aox2 UTSW 1 58346212 splice site probably benign
R1512:Aox2 UTSW 1 58307351 missense probably benign 0.00
R1573:Aox2 UTSW 1 58309027 missense probably benign 0.00
R1592:Aox2 UTSW 1 58300694 missense probably benign 0.00
R1747:Aox2 UTSW 1 58339592 missense probably benign 0.01
R1768:Aox2 UTSW 1 58354195 missense probably benign 0.00
R1809:Aox2 UTSW 1 58294325 missense probably benign
R1823:Aox2 UTSW 1 58312359 missense probably benign 0.02
R1834:Aox2 UTSW 1 58308991 missense probably benign 0.08
R1835:Aox2 UTSW 1 58308991 missense probably benign 0.08
R1836:Aox2 UTSW 1 58308991 missense probably benign 0.08
R2219:Aox2 UTSW 1 58349130 splice site probably null
R2220:Aox2 UTSW 1 58349130 splice site probably null
R2508:Aox2 UTSW 1 58343673 missense probably benign 0.38
R2942:Aox2 UTSW 1 58337381 missense probably benign 0.03
R2967:Aox2 UTSW 1 58322834 missense probably damaging 0.96
R3082:Aox2 UTSW 1 58283600 splice site probably benign
R3161:Aox2 UTSW 1 58304438 missense possibly damaging 0.91
R3408:Aox2 UTSW 1 58343668 missense probably benign 0.32
R3803:Aox2 UTSW 1 58289899 splice site probably null
R3894:Aox2 UTSW 1 58334678 critical splice acceptor site probably null
R4214:Aox2 UTSW 1 58307444 critical splice donor site probably null
R4249:Aox2 UTSW 1 58299819 missense probably benign 0.01
R4666:Aox2 UTSW 1 58304597 nonsense probably null
R4668:Aox2 UTSW 1 58334694 missense possibly damaging 0.63
R4703:Aox2 UTSW 1 58358957 missense possibly damaging 0.78
R4758:Aox2 UTSW 1 58332582 missense probably benign 0.00
R4890:Aox2 UTSW 1 58334703 missense probably benign 0.11
R4900:Aox2 UTSW 1 58305385 missense probably benign
R4924:Aox2 UTSW 1 58305344 missense probably damaging 1.00
R4970:Aox2 UTSW 1 58310095 splice site probably null
R5112:Aox2 UTSW 1 58310095 splice site probably null
R5987:Aox2 UTSW 1 58307359 missense probably benign 0.00
R6239:Aox2 UTSW 1 58305391 critical splice donor site probably null
R6273:Aox2 UTSW 1 58339672 missense probably benign 0.00
R6291:Aox2 UTSW 1 58330806 missense probably damaging 0.98
R6334:Aox2 UTSW 1 58307407 nonsense probably null
R6764:Aox2 UTSW 1 58350282 missense probably damaging 0.97
R6766:Aox2 UTSW 1 58349068 missense possibly damaging 0.95
R6789:Aox2 UTSW 1 58304485 missense probably benign 0.01
R6804:Aox2 UTSW 1 58304598 missense probably benign 0.04
R7007:Aox2 UTSW 1 58330892 missense probably damaging 1.00
R7015:Aox2 UTSW 1 58282758 missense probably benign 0.00
R7055:Aox2 UTSW 1 58299768 missense probably benign 0.08
R7089:Aox2 UTSW 1 58336649 missense probably benign 0.01
R7157:Aox2 UTSW 1 58283492 missense probably benign 0.00
R7303:Aox2 UTSW 1 58334765 nonsense probably null
R7426:Aox2 UTSW 1 58289983 nonsense probably null
R7762:Aox2 UTSW 1 58349104 missense probably damaging 1.00
R7899:Aox2 UTSW 1 58281237 splice site probably null
R7942:Aox2 UTSW 1 58337431 missense probably damaging 1.00
R7975:Aox2 UTSW 1 58309028 missense probably benign 0.02
R8029:Aox2 UTSW 1 58343668 missense probably benign 0.32
R8032:Aox2 UTSW 1 58350283 missense probably benign 0.01
R8147:Aox2 UTSW 1 58300662 missense probably benign 0.02
R8165:Aox2 UTSW 1 58308929 missense probably benign 0.08
R8326:Aox2 UTSW 1 58295887 missense probably benign
R8770:Aox2 UTSW 1 58339604 missense probably benign 0.10
R8973:Aox2 UTSW 1 58289954 missense probably benign 0.34
R9015:Aox2 UTSW 1 58343692 missense probably damaging 1.00
R9097:Aox2 UTSW 1 58287728 missense possibly damaging 0.82
R9101:Aox2 UTSW 1 58332637 missense probably benign 0.03
R9108:Aox2 UTSW 1 58282692 missense probably damaging 1.00
R9180:Aox2 UTSW 1 58339618 nonsense probably null
R9293:Aox2 UTSW 1 58322794 missense possibly damaging 0.86
R9519:Aox2 UTSW 1 58334767 missense probably damaging 0.98
R9581:Aox2 UTSW 1 58330896 critical splice donor site probably null
Z1177:Aox2 UTSW 1 58354397 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CACTATTACGGTGTGGAGAGTG -3'
(R):5'- ATGATGATGCTCTCGACCTCAC -3'

Sequencing Primer
(F):5'- GGTTTACAGAGCAAGCCCTGTTAC -3'
(R):5'- CCACATGTATGTCTATGTGCCAGG -3'
Posted On 2022-03-25