Incidental Mutation 'R9258:Ifih1'
ID 701989
Institutional Source Beutler Lab
Gene Symbol Ifih1
Ensembl Gene ENSMUSG00000026896
Gene Name interferon induced with helicase C domain 1
Synonyms MDA5, 9130009C22Rik, Helicard, MDA-5
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.144) question?
Stock # R9258 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 62426142-62476599 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 62442242 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 374 (F374S)
Ref Sequence ENSEMBL: ENSMUSP00000028259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028259] [ENSMUST00000112459]
AlphaFold Q8R5F7
PDB Structure Crystal Structure of the MDA5 Helicase Insert Domain [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028259
AA Change: F374S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028259
Gene: ENSMUSG00000026896
AA Change: F374S

DomainStartEndE-ValueType
Pfam:CARD_2 7 99 3e-22 PFAM
Pfam:CARD_2 110 200 6.8e-22 PFAM
Pfam:CARD 115 200 2.6e-15 PFAM
low complexity region 248 261 N/A INTRINSIC
DEXDc 305 520 1.08e-26 SMART
Blast:DEXDc 590 712 1e-45 BLAST
HELICc 742 826 1.27e-14 SMART
Pfam:RIG-I_C-RD 903 1018 4.2e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112459
AA Change: F325S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108078
Gene: ENSMUSG00000026896
AA Change: F325S

DomainStartEndE-ValueType
SCOP:d3ygsp_ 6 88 1e-3 SMART
Pfam:CARD 115 200 3.9e-15 PFAM
DEXDc 256 471 1.08e-26 SMART
Blast:DEXDc 541 663 1e-45 BLAST
HELICc 693 777 1.27e-14 SMART
Pfam:RIG-I_C-RD 852 973 1.5e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein that is upregulated in response to treatment with beta-interferon and a protein kinase C-activating compound, mezerein. Irreversible reprogramming of melanomas can be achieved by treatment with both these agents; treatment with either agent alone only achieves reversible differentiation. Genetic variation in this gene is associated with diabetes mellitus insulin-dependent type 19. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele have increased virus-associated morbidity and mortality, and decreased cytokine response to several viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 T A 8: 124,709,347 (GRCm39) Q69L probably benign Het
Abtb2 A C 2: 103,546,410 (GRCm39) Q930P probably null Het
Adam18 G A 8: 25,158,574 (GRCm39) T73I probably benign Het
Ankrd54 A T 15: 78,946,996 (GRCm39) M1K probably null Het
Anks1 T C 17: 28,277,400 (GRCm39) V1106A probably damaging Het
Aox1 A T 1: 58,351,515 (GRCm39) I701F probably damaging Het
Arfgef3 C T 10: 18,465,387 (GRCm39) R2152H probably damaging Het
Arnt2 C T 7: 84,010,798 (GRCm39) G37E probably damaging Het
Arpp21 G A 9: 111,953,956 (GRCm39) T581M probably benign Het
Arvcf A G 16: 18,216,957 (GRCm39) N428S probably damaging Het
C2cd3 A G 7: 100,098,026 (GRCm39) E1471G Het
Cadm1 A G 9: 47,710,730 (GRCm39) K211R probably benign Het
Cdh6 A G 15: 13,064,462 (GRCm39) S143P probably damaging Het
Cep152 G A 2: 125,421,356 (GRCm39) Q1125* probably null Het
Cfap54 A C 10: 92,770,960 (GRCm39) S2095A unknown Het
Col12a1 T C 9: 79,613,645 (GRCm39) T67A probably benign Het
Col6a3 T C 1: 90,700,703 (GRCm39) N3216S unknown Het
Cpeb2 T A 5: 43,391,455 (GRCm39) L217Q Het
Ctbp2 A T 7: 132,597,021 (GRCm39) N119K probably damaging Het
Des G T 1: 75,340,289 (GRCm39) V399L probably benign Het
Dnah2 G T 11: 69,368,079 (GRCm39) H1753Q probably damaging Het
Dnajc6 T C 4: 101,475,813 (GRCm39) V562A probably benign Het
Dusp13b T C 14: 21,791,155 (GRCm39) D99G probably benign Het
Ehd3 A G 17: 74,127,561 (GRCm39) I165V probably benign Het
Eme2 C T 17: 25,112,053 (GRCm39) V241M probably damaging Het
Eml5 A G 12: 98,810,376 (GRCm39) L860P possibly damaging Het
Eogt T A 6: 97,089,043 (GRCm39) K521M possibly damaging Het
Epb41l5 T C 1: 119,506,701 (GRCm39) T489A probably benign Het
Fmo5 G T 3: 97,558,802 (GRCm39) V421L probably benign Het
Gabpa C T 16: 84,653,403 (GRCm39) P268S probably benign Het
Gas2l3 G T 10: 89,262,315 (GRCm39) H136N probably benign Het
Gm5592 C T 7: 40,938,407 (GRCm39) A563V possibly damaging Het
Gpn3 A T 5: 122,519,508 (GRCm39) D205V probably benign Het
H13 T C 2: 152,522,999 (GRCm39) L104S probably damaging Het
H2-Q4 T A 17: 35,599,105 (GRCm39) V125E probably benign Het
Ildr2 A G 1: 166,131,158 (GRCm39) D338G probably damaging Het
Kmt2b A T 7: 30,281,893 (GRCm39) N1162K probably null Het
Lmntd1 T C 6: 145,359,256 (GRCm39) D298G probably damaging Het
Lrrc32 T A 7: 98,148,345 (GRCm39) V375E probably benign Het
Lrrc37a A C 11: 103,393,022 (GRCm39) I801R probably benign Het
Matcap1 A G 8: 106,008,775 (GRCm39) V414A probably damaging Het
Mgam A G 6: 40,657,121 (GRCm39) E935G probably benign Het
Mms22l A T 4: 24,588,238 (GRCm39) T917S probably damaging Het
Myo3a A T 2: 22,467,545 (GRCm39) E1204D possibly damaging Het
Nav3 T A 10: 109,550,243 (GRCm39) E1829V probably damaging Het
Nccrp1 C T 7: 28,245,632 (GRCm39) G150D probably damaging Het
Nlrp4b G T 7: 10,444,087 (GRCm39) W12L probably damaging Het
Nmb T C 7: 80,554,001 (GRCm39) T71A possibly damaging Het
Ogfod2 T A 5: 124,250,505 (GRCm39) H35Q probably benign Het
Ola1 A T 2: 72,929,732 (GRCm39) S290R probably damaging Het
Or1e30 T G 11: 73,678,281 (GRCm39) N172K probably benign Het
Or4k47 A T 2: 111,452,329 (GRCm39) I30N possibly damaging Het
Or51v15-ps1 T G 7: 103,278,543 (GRCm39) Y208S unknown Het
Or52e2 C A 7: 102,804,409 (GRCm39) E182* probably null Het
Or5p68 T G 7: 107,945,886 (GRCm39) T101P probably benign Het
Or9i14 A T 19: 13,792,099 (GRCm39) L285* probably null Het
Pcsk9 T C 4: 106,316,047 (GRCm39) D132G possibly damaging Het
Pkhd1 A T 1: 20,444,174 (GRCm39) V2296E probably damaging Het
Prl2c5 A T 13: 13,365,297 (GRCm39) I151L probably damaging Het
Prl3d3 A T 13: 27,344,931 (GRCm39) D101V possibly damaging Het
Prrt1 A G 17: 34,850,120 (GRCm39) Y178C probably damaging Het
Rasal1 A T 5: 120,793,155 (GRCm39) I87F possibly damaging Het
Rpgrip1l A T 8: 91,987,614 (GRCm39) Y814* probably null Het
Rpl3l T G 17: 24,951,447 (GRCm39) probably null Het
Rrbp1 C A 2: 143,853,161 (GRCm39) probably benign Het
Ryr3 A G 2: 112,483,364 (GRCm39) S4158P probably damaging Het
Scube2 G T 7: 109,398,515 (GRCm39) S951Y probably damaging Het
Sec14l1 T C 11: 117,041,002 (GRCm39) V396A probably benign Het
Sh3gl1 T A 17: 56,325,911 (GRCm39) K173* probably null Het
Shank3 A T 15: 89,388,521 (GRCm39) E371V probably damaging Het
Slc25a24 A G 3: 109,066,751 (GRCm39) T302A probably damaging Het
Slc25a41 A T 17: 57,348,580 (GRCm39) H4Q probably benign Het
Slc45a1 A T 4: 150,723,071 (GRCm39) V271D possibly damaging Het
Smad6 A T 9: 63,927,573 (GRCm39) L245Q probably damaging Het
Smad7 C A 18: 75,527,317 (GRCm39) Q388K probably damaging Het
Snx29 G T 16: 11,532,799 (GRCm39) D348Y possibly damaging Het
Son A T 16: 91,474,570 (GRCm39) H2418L unknown Het
Sppl3 G A 5: 115,233,922 (GRCm39) V331M probably damaging Het
St13 T G 15: 81,272,569 (GRCm39) T92P probably benign Het
St3gal4 A G 9: 34,963,643 (GRCm39) W222R probably damaging Het
Stk32a T A 18: 43,444,999 (GRCm39) N264K probably benign Het
Stoml3 T A 3: 53,405,397 (GRCm39) I26N possibly damaging Het
Taf7 T C 18: 37,776,021 (GRCm39) E182G probably damaging Het
Tas2r138 A G 6: 40,590,129 (GRCm39) V39A probably damaging Het
Tbc1d12 A G 19: 38,889,823 (GRCm39) S418G possibly damaging Het
Tbr1 T A 2: 61,642,723 (GRCm39) C663S probably benign Het
Tmc5 A T 7: 118,222,501 (GRCm39) Y67F probably benign Het
Tnfsf4 A C 1: 161,244,814 (GRCm39) I168L probably benign Het
Trav5-1 T G 14: 52,860,347 (GRCm39) S51A probably benign Het
Trmt10c A T 16: 55,854,646 (GRCm39) C330S possibly damaging Het
Trpm1 T C 7: 63,884,713 (GRCm39) M798T probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 115,958,998 (GRCm39) probably benign Het
Unc13d CATGCC CATGCCTCCGATGCC 11: 115,959,007 (GRCm39) probably benign Het
Vmn1r199 A G 13: 22,566,822 (GRCm39) T39A possibly damaging Het
Vmn1r74 T A 7: 11,580,999 (GRCm39) C100S possibly damaging Het
Vmn2r77 T A 7: 86,452,302 (GRCm39) I494K possibly damaging Het
Wdr17 G A 8: 55,112,654 (GRCm39) Q816* probably null Het
Other mutations in Ifih1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Ifih1 APN 2 62,476,214 (GRCm39) missense probably damaging 1.00
IGL00832:Ifih1 APN 2 62,475,814 (GRCm39) splice site probably benign
IGL00906:Ifih1 APN 2 62,476,168 (GRCm39) missense probably benign
IGL01664:Ifih1 APN 2 62,442,044 (GRCm39) splice site probably benign
IGL01820:Ifih1 APN 2 62,447,657 (GRCm39) missense probably damaging 1.00
IGL02016:Ifih1 APN 2 62,437,328 (GRCm39) missense probably benign 0.01
IGL02298:Ifih1 APN 2 62,440,783 (GRCm39) critical splice donor site probably null
IGL02311:Ifih1 APN 2 62,440,847 (GRCm39) missense probably damaging 1.00
IGL02635:Ifih1 APN 2 62,442,173 (GRCm39) missense probably damaging 1.00
Washington UTSW 2 62,429,143 (GRCm39) missense possibly damaging 0.88
R0514:Ifih1 UTSW 2 62,453,735 (GRCm39) critical splice donor site probably null
R1329:Ifih1 UTSW 2 62,447,831 (GRCm39) splice site probably null
R1484:Ifih1 UTSW 2 62,440,902 (GRCm39) missense probably benign 0.00
R1769:Ifih1 UTSW 2 62,436,738 (GRCm39) missense probably damaging 1.00
R2104:Ifih1 UTSW 2 62,440,889 (GRCm39) nonsense probably null
R2125:Ifih1 UTSW 2 62,453,811 (GRCm39) missense probably benign 0.43
R2126:Ifih1 UTSW 2 62,453,811 (GRCm39) missense probably benign 0.43
R2406:Ifih1 UTSW 2 62,437,447 (GRCm39) splice site probably benign
R3919:Ifih1 UTSW 2 62,453,845 (GRCm39) splice site probably benign
R4033:Ifih1 UTSW 2 62,465,534 (GRCm39) missense probably benign
R4060:Ifih1 UTSW 2 62,429,143 (GRCm39) missense possibly damaging 0.88
R4435:Ifih1 UTSW 2 62,476,234 (GRCm39) missense probably damaging 1.00
R4538:Ifih1 UTSW 2 62,447,756 (GRCm39) missense probably damaging 1.00
R4663:Ifih1 UTSW 2 62,439,563 (GRCm39) missense probably benign 0.00
R4703:Ifih1 UTSW 2 62,429,220 (GRCm39) missense probably benign 0.05
R4897:Ifih1 UTSW 2 62,465,358 (GRCm39) intron probably benign
R5274:Ifih1 UTSW 2 62,442,062 (GRCm39) missense probably benign 0.00
R5949:Ifih1 UTSW 2 62,440,904 (GRCm39) missense probably benign 0.05
R6140:Ifih1 UTSW 2 62,431,804 (GRCm39) missense possibly damaging 0.77
R6223:Ifih1 UTSW 2 62,428,603 (GRCm39) missense probably benign
R6332:Ifih1 UTSW 2 62,469,827 (GRCm39) missense possibly damaging 0.64
R6650:Ifih1 UTSW 2 62,436,791 (GRCm39) missense possibly damaging 0.69
R6813:Ifih1 UTSW 2 62,476,037 (GRCm39) missense possibly damaging 0.90
R6977:Ifih1 UTSW 2 62,436,530 (GRCm39) missense probably damaging 1.00
R7054:Ifih1 UTSW 2 62,440,859 (GRCm39) missense probably benign 0.30
R7167:Ifih1 UTSW 2 62,429,240 (GRCm39) missense probably benign
R7269:Ifih1 UTSW 2 62,475,977 (GRCm39) missense probably benign 0.00
R7397:Ifih1 UTSW 2 62,453,832 (GRCm39) missense possibly damaging 0.85
R7885:Ifih1 UTSW 2 62,431,813 (GRCm39) missense possibly damaging 0.96
R8672:Ifih1 UTSW 2 62,435,993 (GRCm39) missense possibly damaging 0.82
R8960:Ifih1 UTSW 2 62,442,235 (GRCm39) missense possibly damaging 0.89
R9324:Ifih1 UTSW 2 62,475,950 (GRCm39) missense probably benign
R9432:Ifih1 UTSW 2 62,439,618 (GRCm39) missense probably damaging 1.00
Z1176:Ifih1 UTSW 2 62,447,813 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCACTTCAATGACGCCTTG -3'
(R):5'- CTCGGTGACACTGAGTTACTC -3'

Sequencing Primer
(F):5'- TGACAGCTGCACACCGTC -3'
(R):5'- CGGTGACACTGAGTTACTCTAAGTC -3'
Posted On 2022-03-25