Incidental Mutation 'R9258:Gm5592'
ID 702017
Institutional Source Beutler Lab
Gene Symbol Gm5592
Ensembl Gene ENSMUSG00000072259
Gene Name predicted gene 5592
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R9258 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 41153841-41290183 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 41288983 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 563 (A563V)
Ref Sequence ENSEMBL: ENSMUSP00000094809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097044] [ENSMUST00000206490]
AlphaFold Q3V0A6
Predicted Effect possibly damaging
Transcript: ENSMUST00000097044
AA Change: A563V

PolyPhen 2 Score 0.563 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000094809
Gene: ENSMUSG00000072259
AA Change: A563V

DomainStartEndE-ValueType
Pfam:DUF4629 435 580 6.1e-60 PFAM
low complexity region 607 612 N/A INTRINSIC
low complexity region 708 725 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000206490
AA Change: A563V

PolyPhen 2 Score 0.563 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik A G 8: 105,282,143 V414A probably damaging Het
Abcb10 T A 8: 123,982,608 Q69L probably benign Het
Abtb2 A C 2: 103,716,065 Q930P probably null Het
Adam18 G A 8: 24,668,558 T73I probably benign Het
Ankrd54 A T 15: 79,062,796 M1K probably null Het
Anks1 T C 17: 28,058,426 V1106A probably damaging Het
Aox2 A T 1: 58,312,356 I701F probably damaging Het
Arfgef3 C T 10: 18,589,639 R2152H probably damaging Het
Arnt2 C T 7: 84,361,590 G37E probably damaging Het
Arpp21 G A 9: 112,124,888 T581M probably benign Het
Arvcf A G 16: 18,398,207 N428S probably damaging Het
C2cd3 A G 7: 100,448,819 E1471G Het
Cadm1 A G 9: 47,799,432 K211R probably benign Het
Cdh6 A G 15: 13,064,376 S143P probably damaging Het
Cep152 G A 2: 125,579,436 Q1125* probably null Het
Cfap54 A C 10: 92,935,098 S2095A unknown Het
Col12a1 T C 9: 79,706,363 T67A probably benign Het
Col6a3 T C 1: 90,772,981 N3216S unknown Het
Cpeb2 T A 5: 43,234,112 L217Q Het
Ctbp2 A T 7: 132,995,292 N119K probably damaging Het
Des G T 1: 75,363,645 V399L probably benign Het
Dnah2 G T 11: 69,477,253 H1753Q probably damaging Het
Dnajc6 T C 4: 101,618,616 V562A probably benign Het
Dusp13 T C 14: 21,741,087 D99G probably benign Het
Ehd3 A G 17: 73,820,566 I165V probably benign Het
Eme2 C T 17: 24,893,079 V241M probably damaging Het
Eml5 A G 12: 98,844,117 L860P possibly damaging Het
Eogt T A 6: 97,112,082 K521M possibly damaging Het
Epb41l5 T C 1: 119,578,971 T489A probably benign Het
Fmo5 G T 3: 97,651,486 V421L probably benign Het
Gabpa C T 16: 84,856,515 P268S probably benign Het
Gas2l3 G T 10: 89,426,453 H136N probably benign Het
Gpn3 A T 5: 122,381,445 D205V probably benign Het
H13 T C 2: 152,681,079 L104S probably damaging Het
H2-Q4 T A 17: 35,380,129 V125E probably benign Het
Ifih1 A G 2: 62,611,898 F374S probably damaging Het
Ildr2 A G 1: 166,303,589 D338G probably damaging Het
Kmt2b A T 7: 30,582,468 N1162K probably null Het
Lmntd1 T C 6: 145,413,530 D298G probably damaging Het
Lrrc32 T A 7: 98,499,138 V375E probably benign Het
Lrrc37a A C 11: 103,502,196 I801R probably benign Het
Mgam A G 6: 40,680,187 E935G probably benign Het
Mms22l A T 4: 24,588,238 T917S probably damaging Het
Myo3a A T 2: 22,577,533 E1204D possibly damaging Het
Nav3 T A 10: 109,714,382 E1829V probably damaging Het
Nccrp1 C T 7: 28,546,207 G150D probably damaging Het
Nlrp4b G T 7: 10,710,160 W12L probably damaging Het
Nmb T C 7: 80,904,253 T71A possibly damaging Het
Ogfod2 T A 5: 124,112,442 H35Q probably benign Het
Ola1 A T 2: 73,099,388 S290R probably damaging Het
Olfr1297 A T 2: 111,621,984 I30N possibly damaging Het
Olfr1499 A T 19: 13,814,735 L285* probably null Het
Olfr390 T G 11: 73,787,455 N172K probably benign Het
Olfr493 T G 7: 108,346,679 T101P probably benign Het
Olfr589 C A 7: 103,155,202 E182* probably null Het
Olfr621-ps1 T G 7: 103,629,336 Y208S unknown Het
Pcsk9 T C 4: 106,458,850 D132G possibly damaging Het
Pkhd1 A T 1: 20,373,950 V2296E probably damaging Het
Prl2c5 A T 13: 13,190,712 I151L probably damaging Het
Prl3d3 A T 13: 27,160,948 D101V possibly damaging Het
Prrt1 A G 17: 34,631,146 Y178C probably damaging Het
Rasal1 A T 5: 120,655,090 I87F possibly damaging Het
Rpgrip1l A T 8: 91,260,986 Y814* probably null Het
Rpl3l T G 17: 24,732,473 probably null Het
Rrbp1 C A 2: 144,011,241 probably benign Het
Ryr3 A G 2: 112,653,019 S4158P probably damaging Het
Scube2 G T 7: 109,799,308 S951Y probably damaging Het
Sec14l1 T C 11: 117,150,176 V396A probably benign Het
Sh3gl1 T A 17: 56,018,911 K173* probably null Het
Shank3 A T 15: 89,504,318 E371V probably damaging Het
Slc25a24 A G 3: 109,159,435 T302A probably damaging Het
Slc25a41 A T 17: 57,041,580 H4Q probably benign Het
Slc45a1 A T 4: 150,638,614 V271D possibly damaging Het
Smad6 A T 9: 64,020,291 L245Q probably damaging Het
Smad7 C A 18: 75,394,246 Q388K probably damaging Het
Snx29 G T 16: 11,714,935 D348Y possibly damaging Het
Son A T 16: 91,677,682 H2418L unknown Het
Sppl3 G A 5: 115,095,863 V331M probably damaging Het
St13 T G 15: 81,388,368 T92P probably benign Het
St3gal4 A G 9: 35,052,347 W222R probably damaging Het
Stk32a T A 18: 43,311,934 N264K probably benign Het
Stoml3 T A 3: 53,497,976 I26N possibly damaging Het
Taf7 T C 18: 37,642,968 E182G probably damaging Het
Tas2r138 A G 6: 40,613,195 V39A probably damaging Het
Tbc1d12 A G 19: 38,901,379 S418G possibly damaging Het
Tbr1 T A 2: 61,812,379 C663S probably benign Het
Tmc5 A T 7: 118,623,278 Y67F probably benign Het
Tnfsf4 A C 1: 161,417,243 I168L probably benign Het
Trav5-1 T G 14: 52,622,890 S51A probably benign Het
Trmt10c A T 16: 56,034,283 C330S possibly damaging Het
Trpm1 T C 7: 64,234,965 M798T probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Unc13d CATGCC CATGCCTCCGATGCC 11: 116,068,181 probably benign Het
Vmn1r199 A G 13: 22,382,652 T39A possibly damaging Het
Vmn1r74 T A 7: 11,847,072 C100S possibly damaging Het
Vmn2r77 T A 7: 86,803,094 I494K possibly damaging Het
Wdr17 G A 8: 54,659,619 Q816* probably null Het
Other mutations in Gm5592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Gm5592 APN 7 41289095 missense probably damaging 1.00
IGL01472:Gm5592 APN 7 41286074 splice site probably benign
IGL01718:Gm5592 APN 7 41289193 missense probably damaging 0.99
IGL01981:Gm5592 APN 7 41286371 nonsense probably null
IGL02318:Gm5592 APN 7 41286788 missense probably benign 0.37
IGL02346:Gm5592 APN 7 41289465 missense probably damaging 0.97
IGL02904:Gm5592 APN 7 41288386 missense probably damaging 1.00
I1329:Gm5592 UTSW 7 41286354 nonsense probably null
R0465:Gm5592 UTSW 7 41156057 intron probably benign
R0669:Gm5592 UTSW 7 41155830 intron probably benign
R0675:Gm5592 UTSW 7 41289387 missense possibly damaging 0.81
R1381:Gm5592 UTSW 7 41286172 missense probably benign
R1731:Gm5592 UTSW 7 41288413 missense probably damaging 0.99
R3149:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3150:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3176:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3177:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3276:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3277:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3623:Gm5592 UTSW 7 41157628 intron probably benign
R3797:Gm5592 UTSW 7 41157835 intron probably benign
R3854:Gm5592 UTSW 7 41157835 intron probably benign
R3856:Gm5592 UTSW 7 41157835 intron probably benign
R4009:Gm5592 UTSW 7 41289510 missense probably benign 0.01
R4010:Gm5592 UTSW 7 41286628 missense probably benign 0.05
R4011:Gm5592 UTSW 7 41289510 missense probably benign 0.01
R4127:Gm5592 UTSW 7 41289067 missense probably benign 0.00
R4162:Gm5592 UTSW 7 41217778 intron probably benign
R4289:Gm5592 UTSW 7 41158912 intron probably benign
R4304:Gm5592 UTSW 7 41286262 missense probably benign 0.20
R4332:Gm5592 UTSW 7 41216118 intron probably benign
R4408:Gm5592 UTSW 7 41286448 missense probably benign 0.04
R4572:Gm5592 UTSW 7 41216159 intron probably benign
R4764:Gm5592 UTSW 7 41216118 intron probably benign
R4822:Gm5592 UTSW 7 41155890 intron probably benign
R4836:Gm5592 UTSW 7 41215534 intron probably benign
R4854:Gm5592 UTSW 7 41217471 intron probably benign
R5032:Gm5592 UTSW 7 41289735 missense probably damaging 1.00
R5075:Gm5592 UTSW 7 41158963 intron probably benign
R5369:Gm5592 UTSW 7 41218211 intron probably benign
R5424:Gm5592 UTSW 7 41155593 intron probably benign
R5700:Gm5592 UTSW 7 41158579 intron probably benign
R5741:Gm5592 UTSW 7 41289201 missense probably benign
R5802:Gm5592 UTSW 7 41219105 intron probably benign
R5945:Gm5592 UTSW 7 41215612 intron probably benign
R6117:Gm5592 UTSW 7 41288464 missense probably benign 0.00
R6324:Gm5592 UTSW 7 41286535 missense probably damaging 0.98
R6449:Gm5592 UTSW 7 41288586 missense probably benign 0.09
R6571:Gm5592 UTSW 7 41288575 missense probably damaging 0.98
R6776:Gm5592 UTSW 7 41289729 missense probably damaging 1.00
R7595:Gm5592 UTSW 7 41286443 missense probably damaging 0.99
R7658:Gm5592 UTSW 7 41288710 missense probably benign 0.03
R7699:Gm5592 UTSW 7 41286407 missense probably damaging 1.00
R7700:Gm5592 UTSW 7 41286407 missense probably damaging 1.00
R7774:Gm5592 UTSW 7 41289859 missense probably damaging 1.00
R7788:Gm5592 UTSW 7 41286694 missense probably benign 0.01
R7890:Gm5592 UTSW 7 41286759 missense probably damaging 1.00
R8070:Gm5592 UTSW 7 41286463 missense possibly damaging 0.76
R8417:Gm5592 UTSW 7 41288551 missense probably benign 0.38
R8866:Gm5592 UTSW 7 41288822 missense possibly damaging 0.74
R9044:Gm5592 UTSW 7 41288850 missense probably benign 0.25
R9057:Gm5592 UTSW 7 41289463 missense possibly damaging 0.93
R9451:Gm5592 UTSW 7 41286452 missense probably damaging 0.99
X0021:Gm5592 UTSW 7 41288508 missense probably benign 0.01
Z1176:Gm5592 UTSW 7 41286317 missense probably damaging 1.00
Z1176:Gm5592 UTSW 7 41286319 missense possibly damaging 0.94
Z1176:Gm5592 UTSW 7 41288681 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGGGCTATTGACAACATGGC -3'
(R):5'- AGGAAACTGGCCCTCACATG -3'

Sequencing Primer
(F):5'- GGCAAAGCTCCCAAAGGGC -3'
(R):5'- CTCACATGGCATGTTTAACACTG -3'
Posted On 2022-03-25