Incidental Mutation 'R9258:Trpm1'
ID 702018
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Name transient receptor potential cation channel, subfamily M, member 1
Synonyms Mlsn1, 4732499L03Rik, LTRPC1, melastatin
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9258 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 64153835-64269775 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 64234965 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 798 (M798T)
Ref Sequence ENSEMBL: ENSMUSP00000082318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314]
AlphaFold Q2TV84
Predicted Effect probably benign
Transcript: ENSMUST00000085222
AA Change: M798T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: M798T

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000206263
AA Change: M682T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000206277
AA Change: M798T

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000206314
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik A G 8: 105,282,143 V414A probably damaging Het
Abcb10 T A 8: 123,982,608 Q69L probably benign Het
Abtb2 A C 2: 103,716,065 Q930P probably null Het
Adam18 G A 8: 24,668,558 T73I probably benign Het
Ankrd54 A T 15: 79,062,796 M1K probably null Het
Anks1 T C 17: 28,058,426 V1106A probably damaging Het
Aox2 A T 1: 58,312,356 I701F probably damaging Het
Arfgef3 C T 10: 18,589,639 R2152H probably damaging Het
Arnt2 C T 7: 84,361,590 G37E probably damaging Het
Arpp21 G A 9: 112,124,888 T581M probably benign Het
Arvcf A G 16: 18,398,207 N428S probably damaging Het
C2cd3 A G 7: 100,448,819 E1471G Het
Cadm1 A G 9: 47,799,432 K211R probably benign Het
Cdh6 A G 15: 13,064,376 S143P probably damaging Het
Cep152 G A 2: 125,579,436 Q1125* probably null Het
Cfap54 A C 10: 92,935,098 S2095A unknown Het
Col12a1 T C 9: 79,706,363 T67A probably benign Het
Col6a3 T C 1: 90,772,981 N3216S unknown Het
Cpeb2 T A 5: 43,234,112 L217Q Het
Ctbp2 A T 7: 132,995,292 N119K probably damaging Het
Des G T 1: 75,363,645 V399L probably benign Het
Dnah2 G T 11: 69,477,253 H1753Q probably damaging Het
Dnajc6 T C 4: 101,618,616 V562A probably benign Het
Dusp13 T C 14: 21,741,087 D99G probably benign Het
Ehd3 A G 17: 73,820,566 I165V probably benign Het
Eme2 C T 17: 24,893,079 V241M probably damaging Het
Eml5 A G 12: 98,844,117 L860P possibly damaging Het
Eogt T A 6: 97,112,082 K521M possibly damaging Het
Epb41l5 T C 1: 119,578,971 T489A probably benign Het
Fmo5 G T 3: 97,651,486 V421L probably benign Het
Gabpa C T 16: 84,856,515 P268S probably benign Het
Gas2l3 G T 10: 89,426,453 H136N probably benign Het
Gm5592 C T 7: 41,288,983 A563V possibly damaging Het
Gpn3 A T 5: 122,381,445 D205V probably benign Het
H13 T C 2: 152,681,079 L104S probably damaging Het
H2-Q4 T A 17: 35,380,129 V125E probably benign Het
Ifih1 A G 2: 62,611,898 F374S probably damaging Het
Ildr2 A G 1: 166,303,589 D338G probably damaging Het
Kmt2b A T 7: 30,582,468 N1162K probably null Het
Lmntd1 T C 6: 145,413,530 D298G probably damaging Het
Lrrc32 T A 7: 98,499,138 V375E probably benign Het
Lrrc37a A C 11: 103,502,196 I801R probably benign Het
Mgam A G 6: 40,680,187 E935G probably benign Het
Mms22l A T 4: 24,588,238 T917S probably damaging Het
Myo3a A T 2: 22,577,533 E1204D possibly damaging Het
Nav3 T A 10: 109,714,382 E1829V probably damaging Het
Nccrp1 C T 7: 28,546,207 G150D probably damaging Het
Nlrp4b G T 7: 10,710,160 W12L probably damaging Het
Nmb T C 7: 80,904,253 T71A possibly damaging Het
Ogfod2 T A 5: 124,112,442 H35Q probably benign Het
Ola1 A T 2: 73,099,388 S290R probably damaging Het
Olfr1297 A T 2: 111,621,984 I30N possibly damaging Het
Olfr1499 A T 19: 13,814,735 L285* probably null Het
Olfr390 T G 11: 73,787,455 N172K probably benign Het
Olfr493 T G 7: 108,346,679 T101P probably benign Het
Olfr589 C A 7: 103,155,202 E182* probably null Het
Olfr621-ps1 T G 7: 103,629,336 Y208S unknown Het
Pcsk9 T C 4: 106,458,850 D132G possibly damaging Het
Pkhd1 A T 1: 20,373,950 V2296E probably damaging Het
Prl2c5 A T 13: 13,190,712 I151L probably damaging Het
Prl3d3 A T 13: 27,160,948 D101V possibly damaging Het
Prrt1 A G 17: 34,631,146 Y178C probably damaging Het
Rasal1 A T 5: 120,655,090 I87F possibly damaging Het
Rpgrip1l A T 8: 91,260,986 Y814* probably null Het
Rpl3l T G 17: 24,732,473 probably null Het
Rrbp1 C A 2: 144,011,241 probably benign Het
Ryr3 A G 2: 112,653,019 S4158P probably damaging Het
Scube2 G T 7: 109,799,308 S951Y probably damaging Het
Sec14l1 T C 11: 117,150,176 V396A probably benign Het
Sh3gl1 T A 17: 56,018,911 K173* probably null Het
Shank3 A T 15: 89,504,318 E371V probably damaging Het
Slc25a24 A G 3: 109,159,435 T302A probably damaging Het
Slc25a41 A T 17: 57,041,580 H4Q probably benign Het
Slc45a1 A T 4: 150,638,614 V271D possibly damaging Het
Smad6 A T 9: 64,020,291 L245Q probably damaging Het
Smad7 C A 18: 75,394,246 Q388K probably damaging Het
Snx29 G T 16: 11,714,935 D348Y possibly damaging Het
Son A T 16: 91,677,682 H2418L unknown Het
Sppl3 G A 5: 115,095,863 V331M probably damaging Het
St13 T G 15: 81,388,368 T92P probably benign Het
St3gal4 A G 9: 35,052,347 W222R probably damaging Het
Stk32a T A 18: 43,311,934 N264K probably benign Het
Stoml3 T A 3: 53,497,976 I26N possibly damaging Het
Taf7 T C 18: 37,642,968 E182G probably damaging Het
Tas2r138 A G 6: 40,613,195 V39A probably damaging Het
Tbc1d12 A G 19: 38,901,379 S418G possibly damaging Het
Tbr1 T A 2: 61,812,379 C663S probably benign Het
Tmc5 A T 7: 118,623,278 Y67F probably benign Het
Tnfsf4 A C 1: 161,417,243 I168L probably benign Het
Trav5-1 T G 14: 52,622,890 S51A probably benign Het
Trmt10c A T 16: 56,034,283 C330S possibly damaging Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Unc13d CATGCC CATGCCTCCGATGCC 11: 116,068,181 probably benign Het
Vmn1r199 A G 13: 22,382,652 T39A possibly damaging Het
Vmn1r74 T A 7: 11,847,072 C100S possibly damaging Het
Vmn2r77 T A 7: 86,803,094 I494K possibly damaging Het
Wdr17 G A 8: 54,659,619 Q816* probably null Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 64243450 missense probably damaging 1.00
IGL00465:Trpm1 APN 7 64247467 missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 64235824 missense probably benign 0.24
IGL01148:Trpm1 APN 7 64243564 missense probably damaging 1.00
IGL01303:Trpm1 APN 7 64210830 critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 64235019 missense probably benign 0.18
IGL01433:Trpm1 APN 7 64204528 missense probably damaging 1.00
IGL01506:Trpm1 APN 7 64243581 missense probably damaging 1.00
IGL01626:Trpm1 APN 7 64268889 missense probably damaging 1.00
IGL01640:Trpm1 APN 7 64226897 missense probably damaging 1.00
IGL01899:Trpm1 APN 7 64234994 missense probably benign 0.24
IGL01959:Trpm1 APN 7 64208975 missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 64210865 missense probably damaging 1.00
IGL02268:Trpm1 APN 7 64217614 missense probably damaging 0.96
IGL02331:Trpm1 APN 7 64235052 missense probably benign 0.30
IGL02334:Trpm1 APN 7 64245942 critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 64219121 missense probably damaging 1.00
IGL02425:Trpm1 APN 7 64240427 missense probably damaging 0.96
IGL02485:Trpm1 APN 7 64269114 missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 64199224 missense probably benign 0.00
IGL02640:Trpm1 APN 7 64219133 missense probably damaging 0.97
IGL02827:Trpm1 APN 7 64219160 missense probably null 1.00
PIT4458001:Trpm1 UTSW 7 64268561 missense possibly damaging 0.94
PIT4544001:Trpm1 UTSW 7 64199250 intron probably benign
R0012:Trpm1 UTSW 7 64268591 missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 64248222 missense probably damaging 1.00
R0056:Trpm1 UTSW 7 64243586 missense probably damaging 1.00
R0445:Trpm1 UTSW 7 64244842 unclassified probably benign
R0463:Trpm1 UTSW 7 64220254 missense probably benign 0.05
R0469:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R0510:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R1301:Trpm1 UTSW 7 64203053 splice site probably null
R1397:Trpm1 UTSW 7 64217658 missense probably damaging 1.00
R1588:Trpm1 UTSW 7 64223817 missense possibly damaging 0.93
R1618:Trpm1 UTSW 7 64240535 missense probably damaging 1.00
R1724:Trpm1 UTSW 7 64235821 nonsense probably null
R1827:Trpm1 UTSW 7 64235007 missense probably damaging 1.00
R1829:Trpm1 UTSW 7 64226782 missense probably damaging 1.00
R1835:Trpm1 UTSW 7 64230268 missense probably damaging 1.00
R1864:Trpm1 UTSW 7 64268016 missense probably damaging 1.00
R1895:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1946:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1959:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1960:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1980:Trpm1 UTSW 7 64208434 missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 64209032 intron probably null
R2054:Trpm1 UTSW 7 64240555 missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 64234988 missense probably damaging 1.00
R2251:Trpm1 UTSW 7 64209976 missense probably damaging 1.00
R3051:Trpm1 UTSW 7 64269101 missense probably damaging 1.00
R3148:Trpm1 UTSW 7 64235012 missense probably benign 0.00
R3195:Trpm1 UTSW 7 64199313 nonsense probably null
R3615:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3616:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3623:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3624:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3721:Trpm1 UTSW 7 64217727 intron probably benign
R3822:Trpm1 UTSW 7 64217703 intron probably benign
R4441:Trpm1 UTSW 7 64201918 missense probably damaging 1.00
R4490:Trpm1 UTSW 7 64208912 nonsense probably null
R4666:Trpm1 UTSW 7 64203034 missense probably damaging 1.00
R4701:Trpm1 UTSW 7 64243500 missense probably damaging 1.00
R4781:Trpm1 UTSW 7 64235052 missense probably benign 0.30
R4811:Trpm1 UTSW 7 64208306 missense probably damaging 1.00
R5017:Trpm1 UTSW 7 64244832 unclassified probably benign
R5030:Trpm1 UTSW 7 64235831 missense probably damaging 1.00
R5195:Trpm1 UTSW 7 64237693 missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 64268954 missense probably damaging 1.00
R5304:Trpm1 UTSW 7 64208946 missense probably benign 0.00
R5575:Trpm1 UTSW 7 64220270 missense possibly damaging 0.95
R5613:Trpm1 UTSW 7 64208411 missense probably damaging 1.00
R5855:Trpm1 UTSW 7 64268962 nonsense probably null
R5947:Trpm1 UTSW 7 64223799 missense probably benign 0.07
R5988:Trpm1 UTSW 7 64226805 missense probably benign 0.16
R6054:Trpm1 UTSW 7 64268702 missense probably benign 0.00
R6088:Trpm1 UTSW 7 64267976 missense probably damaging 0.98
R6259:Trpm1 UTSW 7 64268478 missense possibly damaging 0.47
R6379:Trpm1 UTSW 7 64199194 missense probably benign 0.00
R6380:Trpm1 UTSW 7 64268297 missense probably benign 0.24
R6429:Trpm1 UTSW 7 64268504 missense probably benign 0.00
R6600:Trpm1 UTSW 7 64154033 start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 64240595 missense probably damaging 0.96
R6939:Trpm1 UTSW 7 64268297 missense probably benign 0.03
R6944:Trpm1 UTSW 7 64243433 missense probably damaging 1.00
R7025:Trpm1 UTSW 7 64226714 critical splice acceptor site probably null
R7112:Trpm1 UTSW 7 64235845 missense probably damaging 0.97
R7168:Trpm1 UTSW 7 64268697 missense probably benign 0.01
R7219:Trpm1 UTSW 7 64204585 missense possibly damaging 0.68
R7224:Trpm1 UTSW 7 64219106 critical splice acceptor site probably null
R7285:Trpm1 UTSW 7 64209981 nonsense probably null
R7367:Trpm1 UTSW 7 64268801 missense probably benign 0.06
R7449:Trpm1 UTSW 7 64208975 missense probably benign 0.14
R7466:Trpm1 UTSW 7 64240582 missense probably damaging 0.99
R7498:Trpm1 UTSW 7 64208909 missense possibly damaging 0.93
R7581:Trpm1 UTSW 7 64204555 missense probably benign 0.00
R7776:Trpm1 UTSW 7 64248191 missense probably benign 0.04
R8062:Trpm1 UTSW 7 64201941 missense probably benign 0.18
R8069:Trpm1 UTSW 7 64208970 missense possibly damaging 0.55
R8157:Trpm1 UTSW 7 64199269 missense probably damaging 1.00
R8219:Trpm1 UTSW 7 64201951 missense probably benign 0.35
R8258:Trpm1 UTSW 7 64269029 missense probably benign 0.10
R8259:Trpm1 UTSW 7 64269029 missense probably benign 0.10
R8320:Trpm1 UTSW 7 64268793 missense possibly damaging 0.56
R8536:Trpm1 UTSW 7 64247407 missense probably damaging 1.00
R8544:Trpm1 UTSW 7 64224608 splice site probably null
R8813:Trpm1 UTSW 7 64202008 missense possibly damaging 0.68
R8912:Trpm1 UTSW 7 64268880 missense probably benign 0.06
R8954:Trpm1 UTSW 7 64208341 missense probably damaging 0.98
R9139:Trpm1 UTSW 7 64199195 missense probably benign 0.00
R9205:Trpm1 UTSW 7 64240571 missense possibly damaging 0.66
R9283:Trpm1 UTSW 7 64223875 missense probably benign 0.18
R9394:Trpm1 UTSW 7 64268732 missense probably benign 0.00
R9430:Trpm1 UTSW 7 64223698 missense probably benign 0.38
R9537:Trpm1 UTSW 7 64153868 unclassified probably benign
R9616:Trpm1 UTSW 7 64208384 missense probably damaging 0.99
R9774:Trpm1 UTSW 7 64248293 missense possibly damaging 0.90
X0026:Trpm1 UTSW 7 64268910 missense probably benign 0.05
Z1176:Trpm1 UTSW 7 64203131 critical splice donor site probably null
Z1176:Trpm1 UTSW 7 64204594 critical splice donor site probably null
Z1177:Trpm1 UTSW 7 64217691 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGATGTGAGCTGCTTTGCC -3'
(R):5'- CCCTGTTAGCAAGCTTTCTAAATG -3'

Sequencing Primer
(F):5'- GAGCTGCTTTGCCCTCCTC -3'
(R):5'- AGCAAGCTTTCTAAATGGTAAACC -3'
Posted On 2022-03-25