Incidental Mutation 'R9258:Vmn2r77'
ID 702021
Institutional Source Beutler Lab
Gene Symbol Vmn2r77
Ensembl Gene ENSMUSG00000090949
Gene Name vomeronasal 2, receptor 77
Synonyms EG546983
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R9258 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 86444349-86461240 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 86452302 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 494 (I494K)
Ref Sequence ENSEMBL: ENSMUSP00000129540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164996]
AlphaFold L7N2B7
Predicted Effect possibly damaging
Transcript: ENSMUST00000164996
AA Change: I494K

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129540
Gene: ENSMUSG00000090949
AA Change: I494K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 467 1.4e-30 PFAM
Pfam:NCD3G 510 562 1e-20 PFAM
Pfam:7tm_3 594 830 2.6e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 T A 8: 124,709,347 (GRCm39) Q69L probably benign Het
Abtb2 A C 2: 103,546,410 (GRCm39) Q930P probably null Het
Adam18 G A 8: 25,158,574 (GRCm39) T73I probably benign Het
Ankrd54 A T 15: 78,946,996 (GRCm39) M1K probably null Het
Anks1 T C 17: 28,277,400 (GRCm39) V1106A probably damaging Het
Aox1 A T 1: 58,351,515 (GRCm39) I701F probably damaging Het
Arfgef3 C T 10: 18,465,387 (GRCm39) R2152H probably damaging Het
Arnt2 C T 7: 84,010,798 (GRCm39) G37E probably damaging Het
Arpp21 G A 9: 111,953,956 (GRCm39) T581M probably benign Het
Arvcf A G 16: 18,216,957 (GRCm39) N428S probably damaging Het
C2cd3 A G 7: 100,098,026 (GRCm39) E1471G Het
Cadm1 A G 9: 47,710,730 (GRCm39) K211R probably benign Het
Cdh6 A G 15: 13,064,462 (GRCm39) S143P probably damaging Het
Cep152 G A 2: 125,421,356 (GRCm39) Q1125* probably null Het
Cfap54 A C 10: 92,770,960 (GRCm39) S2095A unknown Het
Col12a1 T C 9: 79,613,645 (GRCm39) T67A probably benign Het
Col6a3 T C 1: 90,700,703 (GRCm39) N3216S unknown Het
Cpeb2 T A 5: 43,391,455 (GRCm39) L217Q Het
Ctbp2 A T 7: 132,597,021 (GRCm39) N119K probably damaging Het
Des G T 1: 75,340,289 (GRCm39) V399L probably benign Het
Dnah2 G T 11: 69,368,079 (GRCm39) H1753Q probably damaging Het
Dnajc6 T C 4: 101,475,813 (GRCm39) V562A probably benign Het
Dusp13b T C 14: 21,791,155 (GRCm39) D99G probably benign Het
Ehd3 A G 17: 74,127,561 (GRCm39) I165V probably benign Het
Eme2 C T 17: 25,112,053 (GRCm39) V241M probably damaging Het
Eml5 A G 12: 98,810,376 (GRCm39) L860P possibly damaging Het
Eogt T A 6: 97,089,043 (GRCm39) K521M possibly damaging Het
Epb41l5 T C 1: 119,506,701 (GRCm39) T489A probably benign Het
Fmo5 G T 3: 97,558,802 (GRCm39) V421L probably benign Het
Gabpa C T 16: 84,653,403 (GRCm39) P268S probably benign Het
Gas2l3 G T 10: 89,262,315 (GRCm39) H136N probably benign Het
Gm5592 C T 7: 40,938,407 (GRCm39) A563V possibly damaging Het
Gpn3 A T 5: 122,519,508 (GRCm39) D205V probably benign Het
H13 T C 2: 152,522,999 (GRCm39) L104S probably damaging Het
H2-Q4 T A 17: 35,599,105 (GRCm39) V125E probably benign Het
Ifih1 A G 2: 62,442,242 (GRCm39) F374S probably damaging Het
Ildr2 A G 1: 166,131,158 (GRCm39) D338G probably damaging Het
Kmt2b A T 7: 30,281,893 (GRCm39) N1162K probably null Het
Lmntd1 T C 6: 145,359,256 (GRCm39) D298G probably damaging Het
Lrrc32 T A 7: 98,148,345 (GRCm39) V375E probably benign Het
Lrrc37a A C 11: 103,393,022 (GRCm39) I801R probably benign Het
Matcap1 A G 8: 106,008,775 (GRCm39) V414A probably damaging Het
Mgam A G 6: 40,657,121 (GRCm39) E935G probably benign Het
Mms22l A T 4: 24,588,238 (GRCm39) T917S probably damaging Het
Myo3a A T 2: 22,467,545 (GRCm39) E1204D possibly damaging Het
Nav3 T A 10: 109,550,243 (GRCm39) E1829V probably damaging Het
Nccrp1 C T 7: 28,245,632 (GRCm39) G150D probably damaging Het
Nlrp4b G T 7: 10,444,087 (GRCm39) W12L probably damaging Het
Nmb T C 7: 80,554,001 (GRCm39) T71A possibly damaging Het
Ogfod2 T A 5: 124,250,505 (GRCm39) H35Q probably benign Het
Ola1 A T 2: 72,929,732 (GRCm39) S290R probably damaging Het
Or1e30 T G 11: 73,678,281 (GRCm39) N172K probably benign Het
Or4k47 A T 2: 111,452,329 (GRCm39) I30N possibly damaging Het
Or51v15-ps1 T G 7: 103,278,543 (GRCm39) Y208S unknown Het
Or52e2 C A 7: 102,804,409 (GRCm39) E182* probably null Het
Or5p68 T G 7: 107,945,886 (GRCm39) T101P probably benign Het
Or9i14 A T 19: 13,792,099 (GRCm39) L285* probably null Het
Pcsk9 T C 4: 106,316,047 (GRCm39) D132G possibly damaging Het
Pkhd1 A T 1: 20,444,174 (GRCm39) V2296E probably damaging Het
Prl2c5 A T 13: 13,365,297 (GRCm39) I151L probably damaging Het
Prl3d3 A T 13: 27,344,931 (GRCm39) D101V possibly damaging Het
Prrt1 A G 17: 34,850,120 (GRCm39) Y178C probably damaging Het
Rasal1 A T 5: 120,793,155 (GRCm39) I87F possibly damaging Het
Rpgrip1l A T 8: 91,987,614 (GRCm39) Y814* probably null Het
Rpl3l T G 17: 24,951,447 (GRCm39) probably null Het
Rrbp1 C A 2: 143,853,161 (GRCm39) probably benign Het
Ryr3 A G 2: 112,483,364 (GRCm39) S4158P probably damaging Het
Scube2 G T 7: 109,398,515 (GRCm39) S951Y probably damaging Het
Sec14l1 T C 11: 117,041,002 (GRCm39) V396A probably benign Het
Sh3gl1 T A 17: 56,325,911 (GRCm39) K173* probably null Het
Shank3 A T 15: 89,388,521 (GRCm39) E371V probably damaging Het
Slc25a24 A G 3: 109,066,751 (GRCm39) T302A probably damaging Het
Slc25a41 A T 17: 57,348,580 (GRCm39) H4Q probably benign Het
Slc45a1 A T 4: 150,723,071 (GRCm39) V271D possibly damaging Het
Smad6 A T 9: 63,927,573 (GRCm39) L245Q probably damaging Het
Smad7 C A 18: 75,527,317 (GRCm39) Q388K probably damaging Het
Snx29 G T 16: 11,532,799 (GRCm39) D348Y possibly damaging Het
Son A T 16: 91,474,570 (GRCm39) H2418L unknown Het
Sppl3 G A 5: 115,233,922 (GRCm39) V331M probably damaging Het
St13 T G 15: 81,272,569 (GRCm39) T92P probably benign Het
St3gal4 A G 9: 34,963,643 (GRCm39) W222R probably damaging Het
Stk32a T A 18: 43,444,999 (GRCm39) N264K probably benign Het
Stoml3 T A 3: 53,405,397 (GRCm39) I26N possibly damaging Het
Taf7 T C 18: 37,776,021 (GRCm39) E182G probably damaging Het
Tas2r138 A G 6: 40,590,129 (GRCm39) V39A probably damaging Het
Tbc1d12 A G 19: 38,889,823 (GRCm39) S418G possibly damaging Het
Tbr1 T A 2: 61,642,723 (GRCm39) C663S probably benign Het
Tmc5 A T 7: 118,222,501 (GRCm39) Y67F probably benign Het
Tnfsf4 A C 1: 161,244,814 (GRCm39) I168L probably benign Het
Trav5-1 T G 14: 52,860,347 (GRCm39) S51A probably benign Het
Trmt10c A T 16: 55,854,646 (GRCm39) C330S possibly damaging Het
Trpm1 T C 7: 63,884,713 (GRCm39) M798T probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 115,958,998 (GRCm39) probably benign Het
Unc13d CATGCC CATGCCTCCGATGCC 11: 115,959,007 (GRCm39) probably benign Het
Vmn1r199 A G 13: 22,566,822 (GRCm39) T39A possibly damaging Het
Vmn1r74 T A 7: 11,580,999 (GRCm39) C100S possibly damaging Het
Wdr17 G A 8: 55,112,654 (GRCm39) Q816* probably null Het
Other mutations in Vmn2r77
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Vmn2r77 APN 7 86,449,975 (GRCm39) missense probably benign 0.06
IGL01105:Vmn2r77 APN 7 86,460,872 (GRCm39) missense probably damaging 0.99
IGL01367:Vmn2r77 APN 7 86,461,124 (GRCm39) missense probably damaging 0.98
IGL01634:Vmn2r77 APN 7 86,460,857 (GRCm39) missense probably benign
IGL01805:Vmn2r77 APN 7 86,460,395 (GRCm39) missense probably benign 0.18
IGL01868:Vmn2r77 APN 7 86,452,224 (GRCm39) missense probably benign 0.00
IGL01980:Vmn2r77 APN 7 86,450,678 (GRCm39) missense probably benign 0.14
IGL02055:Vmn2r77 APN 7 86,450,763 (GRCm39) missense probably benign 0.00
IGL02066:Vmn2r77 APN 7 86,452,836 (GRCm39) nonsense probably null
IGL02185:Vmn2r77 APN 7 86,444,360 (GRCm39) missense unknown
IGL02200:Vmn2r77 APN 7 86,451,187 (GRCm39) missense probably benign 0.04
IGL02336:Vmn2r77 APN 7 86,451,224 (GRCm39) missense probably damaging 0.99
IGL02445:Vmn2r77 APN 7 86,452,848 (GRCm39) nonsense probably null
IGL02557:Vmn2r77 APN 7 86,444,342 (GRCm39) unclassified probably benign
IGL02659:Vmn2r77 APN 7 86,449,979 (GRCm39) missense probably benign 0.32
IGL02978:Vmn2r77 APN 7 86,460,555 (GRCm39) missense probably benign
IGL03180:Vmn2r77 APN 7 86,450,843 (GRCm39) missense possibly damaging 0.85
IGL03255:Vmn2r77 APN 7 86,461,131 (GRCm39) missense probably benign 0.04
IGL03273:Vmn2r77 APN 7 86,460,494 (GRCm39) missense probably damaging 0.99
R0046:Vmn2r77 UTSW 7 86,451,146 (GRCm39) missense possibly damaging 0.73
R0047:Vmn2r77 UTSW 7 86,460,858 (GRCm39) missense probably benign 0.01
R0066:Vmn2r77 UTSW 7 86,449,964 (GRCm39) missense probably benign 0.17
R0066:Vmn2r77 UTSW 7 86,449,964 (GRCm39) missense probably benign 0.17
R0389:Vmn2r77 UTSW 7 86,450,702 (GRCm39) missense probably benign 0.29
R0635:Vmn2r77 UTSW 7 86,460,383 (GRCm39) missense probably benign
R0689:Vmn2r77 UTSW 7 86,460,872 (GRCm39) missense probably damaging 0.99
R0827:Vmn2r77 UTSW 7 86,451,224 (GRCm39) missense probably damaging 1.00
R1167:Vmn2r77 UTSW 7 86,450,954 (GRCm39) missense probably benign 0.02
R1228:Vmn2r77 UTSW 7 86,450,242 (GRCm39) critical splice donor site probably null
R1353:Vmn2r77 UTSW 7 86,451,394 (GRCm39) missense probably benign 0.29
R1392:Vmn2r77 UTSW 7 86,450,830 (GRCm39) missense probably benign 0.00
R1392:Vmn2r77 UTSW 7 86,450,830 (GRCm39) missense probably benign 0.00
R1613:Vmn2r77 UTSW 7 86,460,356 (GRCm39) missense probably damaging 1.00
R1654:Vmn2r77 UTSW 7 86,461,123 (GRCm39) missense probably damaging 1.00
R1742:Vmn2r77 UTSW 7 86,444,543 (GRCm39) missense probably benign 0.35
R1827:Vmn2r77 UTSW 7 86,450,821 (GRCm39) missense probably damaging 0.99
R1911:Vmn2r77 UTSW 7 86,461,001 (GRCm39) missense probably damaging 1.00
R1974:Vmn2r77 UTSW 7 86,449,964 (GRCm39) missense probably benign 0.17
R2008:Vmn2r77 UTSW 7 86,450,921 (GRCm39) missense probably benign 0.31
R2093:Vmn2r77 UTSW 7 86,450,702 (GRCm39) missense probably benign 0.29
R2143:Vmn2r77 UTSW 7 86,461,152 (GRCm39) missense probably damaging 1.00
R2269:Vmn2r77 UTSW 7 86,460,897 (GRCm39) missense probably benign 0.03
R2972:Vmn2r77 UTSW 7 86,452,893 (GRCm39) missense probably benign 0.01
R2974:Vmn2r77 UTSW 7 86,452,893 (GRCm39) missense probably benign 0.01
R3037:Vmn2r77 UTSW 7 86,450,191 (GRCm39) missense probably benign
R3694:Vmn2r77 UTSW 7 86,450,044 (GRCm39) missense probably damaging 1.00
R3695:Vmn2r77 UTSW 7 86,450,044 (GRCm39) missense probably damaging 1.00
R3805:Vmn2r77 UTSW 7 86,444,368 (GRCm39) nonsense probably null
R3870:Vmn2r77 UTSW 7 86,461,050 (GRCm39) missense probably damaging 1.00
R4732:Vmn2r77 UTSW 7 86,450,195 (GRCm39) missense probably benign 0.00
R4733:Vmn2r77 UTSW 7 86,450,195 (GRCm39) missense probably benign 0.00
R5009:Vmn2r77 UTSW 7 86,451,015 (GRCm39) missense possibly damaging 0.82
R5201:Vmn2r77 UTSW 7 86,460,846 (GRCm39) missense probably damaging 0.98
R5218:Vmn2r77 UTSW 7 86,451,341 (GRCm39) missense probably damaging 0.98
R5469:Vmn2r77 UTSW 7 86,451,271 (GRCm39) missense probably benign 0.01
R5673:Vmn2r77 UTSW 7 86,461,214 (GRCm39) missense probably benign 0.05
R5771:Vmn2r77 UTSW 7 86,461,235 (GRCm39) missense probably benign 0.06
R5832:Vmn2r77 UTSW 7 86,460,670 (GRCm39) nonsense probably null
R5899:Vmn2r77 UTSW 7 86,460,924 (GRCm39) missense probably damaging 1.00
R6151:Vmn2r77 UTSW 7 86,450,878 (GRCm39) missense probably benign 0.00
R6182:Vmn2r77 UTSW 7 86,460,957 (GRCm39) missense probably damaging 1.00
R6326:Vmn2r77 UTSW 7 86,451,031 (GRCm39) missense probably benign
R6419:Vmn2r77 UTSW 7 86,460,767 (GRCm39) missense probably damaging 0.99
R6549:Vmn2r77 UTSW 7 86,450,065 (GRCm39) missense probably benign 0.06
R6874:Vmn2r77 UTSW 7 86,451,286 (GRCm39) missense probably benign 0.00
R6972:Vmn2r77 UTSW 7 86,452,202 (GRCm39) missense probably damaging 1.00
R7056:Vmn2r77 UTSW 7 86,451,023 (GRCm39) missense probably benign 0.06
R7185:Vmn2r77 UTSW 7 86,451,035 (GRCm39) missense probably benign 0.00
R7261:Vmn2r77 UTSW 7 86,460,518 (GRCm39) nonsense probably null
R7298:Vmn2r77 UTSW 7 86,449,979 (GRCm39) missense probably benign 0.00
R7662:Vmn2r77 UTSW 7 86,460,492 (GRCm39) nonsense probably null
R8182:Vmn2r77 UTSW 7 86,460,801 (GRCm39) missense probably damaging 1.00
R8327:Vmn2r77 UTSW 7 86,450,680 (GRCm39) missense probably benign 0.08
R8387:Vmn2r77 UTSW 7 86,450,947 (GRCm39) missense probably benign 0.00
R8825:Vmn2r77 UTSW 7 86,452,855 (GRCm39) missense probably benign
R8898:Vmn2r77 UTSW 7 86,444,430 (GRCm39) missense probably damaging 1.00
R8973:Vmn2r77 UTSW 7 86,452,150 (GRCm39) missense possibly damaging 0.93
R9338:Vmn2r77 UTSW 7 86,460,994 (GRCm39) missense probably damaging 1.00
R9358:Vmn2r77 UTSW 7 86,452,236 (GRCm39) missense probably benign 0.00
R9377:Vmn2r77 UTSW 7 86,444,442 (GRCm39) missense probably benign 0.05
R9404:Vmn2r77 UTSW 7 86,451,247 (GRCm39) missense probably benign
R9673:Vmn2r77 UTSW 7 86,450,171 (GRCm39) missense possibly damaging 0.75
R9679:Vmn2r77 UTSW 7 86,460,741 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCATGTGTTACAGCATCAAATACAG -3'
(R):5'- CTTATGAAGGAGTAAGTGGCAAATC -3'

Sequencing Primer
(F):5'- CATTATTTGTGAAGCACAGTGAATC -3'
(R):5'- AGTAAGTGGCAAATCAAATAGCG -3'
Posted On 2022-03-25