Incidental Mutation 'R9258:C2cd3'
ID 702023
Institutional Source Beutler Lab
Gene Symbol C2cd3
Ensembl Gene ENSMUSG00000047248
Gene Name C2 calcium-dependent domain containing 3
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9258 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 100021440-100119359 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 100098026 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1471 (E1471G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000120196]
AlphaFold Q52KB6
Predicted Effect probably benign
Transcript: ENSMUST00000051777
AA Change: E1849G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248
AA Change: E1849G

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
low complexity region 2110 2125 N/A INTRINSIC
low complexity region 2180 2197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098259
AA Change: E1849G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248
AA Change: E1849G

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000113360
Gene: ENSMUSG00000047248
AA Change: E1471G

DomainStartEndE-ValueType
C2 61 199 2.36e1 SMART
C2 327 436 3.73e0 SMART
C2 526 666 1.47e1 SMART
C2 719 858 1.63e1 SMART
C2 1154 1261 1.43e-2 SMART
low complexity region 1429 1443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120196
AA Change: E618G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113728
Gene: ENSMUSG00000047248
AA Change: E618G

DomainStartEndE-ValueType
low complexity region 297 308 N/A INTRINSIC
C2 415 553 1.5e-1 SMART
C2 681 790 2.4e-2 SMART
C2 880 1020 9.5e-2 SMART
C2 1073 1212 1.1e-1 SMART
C2 1508 1615 9e-5 SMART
low complexity region 1783 1797 N/A INTRINSIC
low complexity region 1928 1940 N/A INTRINSIC
low complexity region 2001 2016 N/A INTRINSIC
low complexity region 2071 2087 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 T A 8: 124,709,347 (GRCm39) Q69L probably benign Het
Abtb2 A C 2: 103,546,410 (GRCm39) Q930P probably null Het
Adam18 G A 8: 25,158,574 (GRCm39) T73I probably benign Het
Ankrd54 A T 15: 78,946,996 (GRCm39) M1K probably null Het
Anks1 T C 17: 28,277,400 (GRCm39) V1106A probably damaging Het
Aox1 A T 1: 58,351,515 (GRCm39) I701F probably damaging Het
Arfgef3 C T 10: 18,465,387 (GRCm39) R2152H probably damaging Het
Arnt2 C T 7: 84,010,798 (GRCm39) G37E probably damaging Het
Arpp21 G A 9: 111,953,956 (GRCm39) T581M probably benign Het
Arvcf A G 16: 18,216,957 (GRCm39) N428S probably damaging Het
Cadm1 A G 9: 47,710,730 (GRCm39) K211R probably benign Het
Cdh6 A G 15: 13,064,462 (GRCm39) S143P probably damaging Het
Cep152 G A 2: 125,421,356 (GRCm39) Q1125* probably null Het
Cfap54 A C 10: 92,770,960 (GRCm39) S2095A unknown Het
Col12a1 T C 9: 79,613,645 (GRCm39) T67A probably benign Het
Col6a3 T C 1: 90,700,703 (GRCm39) N3216S unknown Het
Cpeb2 T A 5: 43,391,455 (GRCm39) L217Q Het
Ctbp2 A T 7: 132,597,021 (GRCm39) N119K probably damaging Het
Des G T 1: 75,340,289 (GRCm39) V399L probably benign Het
Dnah2 G T 11: 69,368,079 (GRCm39) H1753Q probably damaging Het
Dnajc6 T C 4: 101,475,813 (GRCm39) V562A probably benign Het
Dusp13b T C 14: 21,791,155 (GRCm39) D99G probably benign Het
Ehd3 A G 17: 74,127,561 (GRCm39) I165V probably benign Het
Eme2 C T 17: 25,112,053 (GRCm39) V241M probably damaging Het
Eml5 A G 12: 98,810,376 (GRCm39) L860P possibly damaging Het
Eogt T A 6: 97,089,043 (GRCm39) K521M possibly damaging Het
Epb41l5 T C 1: 119,506,701 (GRCm39) T489A probably benign Het
Fmo5 G T 3: 97,558,802 (GRCm39) V421L probably benign Het
Gabpa C T 16: 84,653,403 (GRCm39) P268S probably benign Het
Gas2l3 G T 10: 89,262,315 (GRCm39) H136N probably benign Het
Gm5592 C T 7: 40,938,407 (GRCm39) A563V possibly damaging Het
Gpn3 A T 5: 122,519,508 (GRCm39) D205V probably benign Het
H13 T C 2: 152,522,999 (GRCm39) L104S probably damaging Het
H2-Q4 T A 17: 35,599,105 (GRCm39) V125E probably benign Het
Ifih1 A G 2: 62,442,242 (GRCm39) F374S probably damaging Het
Ildr2 A G 1: 166,131,158 (GRCm39) D338G probably damaging Het
Kmt2b A T 7: 30,281,893 (GRCm39) N1162K probably null Het
Lmntd1 T C 6: 145,359,256 (GRCm39) D298G probably damaging Het
Lrrc32 T A 7: 98,148,345 (GRCm39) V375E probably benign Het
Lrrc37a A C 11: 103,393,022 (GRCm39) I801R probably benign Het
Matcap1 A G 8: 106,008,775 (GRCm39) V414A probably damaging Het
Mgam A G 6: 40,657,121 (GRCm39) E935G probably benign Het
Mms22l A T 4: 24,588,238 (GRCm39) T917S probably damaging Het
Myo3a A T 2: 22,467,545 (GRCm39) E1204D possibly damaging Het
Nav3 T A 10: 109,550,243 (GRCm39) E1829V probably damaging Het
Nccrp1 C T 7: 28,245,632 (GRCm39) G150D probably damaging Het
Nlrp4b G T 7: 10,444,087 (GRCm39) W12L probably damaging Het
Nmb T C 7: 80,554,001 (GRCm39) T71A possibly damaging Het
Ogfod2 T A 5: 124,250,505 (GRCm39) H35Q probably benign Het
Ola1 A T 2: 72,929,732 (GRCm39) S290R probably damaging Het
Or1e30 T G 11: 73,678,281 (GRCm39) N172K probably benign Het
Or4k47 A T 2: 111,452,329 (GRCm39) I30N possibly damaging Het
Or51v15-ps1 T G 7: 103,278,543 (GRCm39) Y208S unknown Het
Or52e2 C A 7: 102,804,409 (GRCm39) E182* probably null Het
Or5p68 T G 7: 107,945,886 (GRCm39) T101P probably benign Het
Or9i14 A T 19: 13,792,099 (GRCm39) L285* probably null Het
Pcsk9 T C 4: 106,316,047 (GRCm39) D132G possibly damaging Het
Pkhd1 A T 1: 20,444,174 (GRCm39) V2296E probably damaging Het
Prl2c5 A T 13: 13,365,297 (GRCm39) I151L probably damaging Het
Prl3d3 A T 13: 27,344,931 (GRCm39) D101V possibly damaging Het
Prrt1 A G 17: 34,850,120 (GRCm39) Y178C probably damaging Het
Rasal1 A T 5: 120,793,155 (GRCm39) I87F possibly damaging Het
Rpgrip1l A T 8: 91,987,614 (GRCm39) Y814* probably null Het
Rpl3l T G 17: 24,951,447 (GRCm39) probably null Het
Rrbp1 C A 2: 143,853,161 (GRCm39) probably benign Het
Ryr3 A G 2: 112,483,364 (GRCm39) S4158P probably damaging Het
Scube2 G T 7: 109,398,515 (GRCm39) S951Y probably damaging Het
Sec14l1 T C 11: 117,041,002 (GRCm39) V396A probably benign Het
Sh3gl1 T A 17: 56,325,911 (GRCm39) K173* probably null Het
Shank3 A T 15: 89,388,521 (GRCm39) E371V probably damaging Het
Slc25a24 A G 3: 109,066,751 (GRCm39) T302A probably damaging Het
Slc25a41 A T 17: 57,348,580 (GRCm39) H4Q probably benign Het
Slc45a1 A T 4: 150,723,071 (GRCm39) V271D possibly damaging Het
Smad6 A T 9: 63,927,573 (GRCm39) L245Q probably damaging Het
Smad7 C A 18: 75,527,317 (GRCm39) Q388K probably damaging Het
Snx29 G T 16: 11,532,799 (GRCm39) D348Y possibly damaging Het
Son A T 16: 91,474,570 (GRCm39) H2418L unknown Het
Sppl3 G A 5: 115,233,922 (GRCm39) V331M probably damaging Het
St13 T G 15: 81,272,569 (GRCm39) T92P probably benign Het
St3gal4 A G 9: 34,963,643 (GRCm39) W222R probably damaging Het
Stk32a T A 18: 43,444,999 (GRCm39) N264K probably benign Het
Stoml3 T A 3: 53,405,397 (GRCm39) I26N possibly damaging Het
Taf7 T C 18: 37,776,021 (GRCm39) E182G probably damaging Het
Tas2r138 A G 6: 40,590,129 (GRCm39) V39A probably damaging Het
Tbc1d12 A G 19: 38,889,823 (GRCm39) S418G possibly damaging Het
Tbr1 T A 2: 61,642,723 (GRCm39) C663S probably benign Het
Tmc5 A T 7: 118,222,501 (GRCm39) Y67F probably benign Het
Tnfsf4 A C 1: 161,244,814 (GRCm39) I168L probably benign Het
Trav5-1 T G 14: 52,860,347 (GRCm39) S51A probably benign Het
Trmt10c A T 16: 55,854,646 (GRCm39) C330S possibly damaging Het
Trpm1 T C 7: 63,884,713 (GRCm39) M798T probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 115,958,998 (GRCm39) probably benign Het
Unc13d CATGCC CATGCCTCCGATGCC 11: 115,959,007 (GRCm39) probably benign Het
Vmn1r199 A G 13: 22,566,822 (GRCm39) T39A possibly damaging Het
Vmn1r74 T A 7: 11,580,999 (GRCm39) C100S possibly damaging Het
Vmn2r77 T A 7: 86,452,302 (GRCm39) I494K possibly damaging Het
Wdr17 G A 8: 55,112,654 (GRCm39) Q816* probably null Het
Other mutations in C2cd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:C2cd3 APN 7 100,040,335 (GRCm39) missense probably benign 0.14
IGL01420:C2cd3 APN 7 100,104,065 (GRCm39) missense probably benign 0.35
IGL01775:C2cd3 APN 7 100,092,638 (GRCm39) missense probably damaging 1.00
IGL01832:C2cd3 APN 7 100,076,421 (GRCm39) missense possibly damaging 0.94
IGL01883:C2cd3 APN 7 100,023,693 (GRCm39) missense possibly damaging 0.80
IGL02664:C2cd3 APN 7 100,068,922 (GRCm39) missense possibly damaging 0.67
IGL02697:C2cd3 APN 7 100,076,376 (GRCm39) unclassified probably benign
IGL02852:C2cd3 APN 7 100,079,396 (GRCm39) missense probably damaging 1.00
IGL03158:C2cd3 APN 7 100,023,683 (GRCm39) missense probably damaging 1.00
R0012:C2cd3 UTSW 7 100,067,729 (GRCm39) missense possibly damaging 0.52
R0012:C2cd3 UTSW 7 100,067,729 (GRCm39) missense possibly damaging 0.52
R0013:C2cd3 UTSW 7 100,065,269 (GRCm39) missense probably damaging 1.00
R0013:C2cd3 UTSW 7 100,065,269 (GRCm39) missense probably damaging 1.00
R0032:C2cd3 UTSW 7 100,093,652 (GRCm39) unclassified probably benign
R0032:C2cd3 UTSW 7 100,093,652 (GRCm39) unclassified probably benign
R0124:C2cd3 UTSW 7 100,118,725 (GRCm39) missense probably benign
R0387:C2cd3 UTSW 7 100,071,714 (GRCm39) splice site probably benign
R0522:C2cd3 UTSW 7 100,044,429 (GRCm39) missense probably benign 0.14
R1124:C2cd3 UTSW 7 100,071,888 (GRCm39) missense probably benign 0.00
R1484:C2cd3 UTSW 7 100,089,397 (GRCm39) missense probably damaging 1.00
R1533:C2cd3 UTSW 7 100,055,284 (GRCm39) missense possibly damaging 0.54
R1631:C2cd3 UTSW 7 100,021,704 (GRCm39) critical splice donor site probably null
R1875:C2cd3 UTSW 7 100,056,232 (GRCm39) missense possibly damaging 0.89
R2059:C2cd3 UTSW 7 100,104,700 (GRCm39) unclassified probably benign
R2060:C2cd3 UTSW 7 100,104,155 (GRCm39) missense probably damaging 1.00
R2348:C2cd3 UTSW 7 100,062,573 (GRCm39) missense probably damaging 1.00
R3103:C2cd3 UTSW 7 100,044,459 (GRCm39) missense possibly damaging 0.47
R3405:C2cd3 UTSW 7 100,039,373 (GRCm39) missense probably benign 0.01
R3687:C2cd3 UTSW 7 100,085,040 (GRCm39) missense probably benign 0.28
R3775:C2cd3 UTSW 7 100,081,205 (GRCm39) missense probably damaging 1.00
R3854:C2cd3 UTSW 7 100,103,808 (GRCm39) critical splice acceptor site probably null
R4359:C2cd3 UTSW 7 100,090,296 (GRCm39) missense probably damaging 1.00
R4403:C2cd3 UTSW 7 100,081,306 (GRCm39) missense probably damaging 1.00
R4446:C2cd3 UTSW 7 100,023,684 (GRCm39) missense probably damaging 1.00
R4646:C2cd3 UTSW 7 100,021,657 (GRCm39) unclassified probably benign
R4705:C2cd3 UTSW 7 100,044,395 (GRCm39) missense possibly damaging 0.77
R4770:C2cd3 UTSW 7 100,092,642 (GRCm39) missense probably damaging 1.00
R4777:C2cd3 UTSW 7 100,065,539 (GRCm39) missense possibly damaging 0.46
R4816:C2cd3 UTSW 7 100,040,226 (GRCm39) missense probably benign 0.01
R4842:C2cd3 UTSW 7 100,065,397 (GRCm39) missense probably benign 0.00
R4858:C2cd3 UTSW 7 100,104,160 (GRCm39) missense probably damaging 1.00
R4871:C2cd3 UTSW 7 100,062,581 (GRCm39) missense possibly damaging 0.79
R4898:C2cd3 UTSW 7 100,055,166 (GRCm39) missense probably damaging 1.00
R5026:C2cd3 UTSW 7 100,109,049 (GRCm39) missense possibly damaging 0.52
R5112:C2cd3 UTSW 7 100,092,692 (GRCm39) missense possibly damaging 0.91
R5242:C2cd3 UTSW 7 100,039,373 (GRCm39) missense probably benign 0.01
R5538:C2cd3 UTSW 7 100,104,700 (GRCm39) critical splice donor site probably null
R5861:C2cd3 UTSW 7 100,093,682 (GRCm39) unclassified probably benign
R6110:C2cd3 UTSW 7 100,090,283 (GRCm39) missense probably damaging 1.00
R6326:C2cd3 UTSW 7 100,065,635 (GRCm39) missense probably benign 0.02
R6429:C2cd3 UTSW 7 100,081,298 (GRCm39) missense probably damaging 1.00
R6610:C2cd3 UTSW 7 100,104,505 (GRCm39) missense probably benign
R6613:C2cd3 UTSW 7 100,044,448 (GRCm39) missense possibly damaging 0.87
R6631:C2cd3 UTSW 7 100,067,747 (GRCm39) missense probably damaging 1.00
R6787:C2cd3 UTSW 7 100,104,553 (GRCm39) missense probably benign
R6837:C2cd3 UTSW 7 100,097,953 (GRCm39) missense probably damaging 1.00
R6849:C2cd3 UTSW 7 100,056,134 (GRCm39) missense probably damaging 1.00
R6860:C2cd3 UTSW 7 100,039,448 (GRCm39) missense probably benign 0.28
R6929:C2cd3 UTSW 7 100,100,826 (GRCm39) missense probably damaging 1.00
R7026:C2cd3 UTSW 7 100,081,299 (GRCm39) missense probably damaging 1.00
R7088:C2cd3 UTSW 7 100,065,388 (GRCm39) missense
R7174:C2cd3 UTSW 7 100,081,405 (GRCm39) missense
R7241:C2cd3 UTSW 7 100,056,257 (GRCm39) missense
R7335:C2cd3 UTSW 7 100,071,810 (GRCm39) missense
R7357:C2cd3 UTSW 7 100,079,310 (GRCm39) missense
R7493:C2cd3 UTSW 7 100,076,433 (GRCm39) missense
R7567:C2cd3 UTSW 7 100,080,022 (GRCm39) missense
R7573:C2cd3 UTSW 7 100,068,914 (GRCm39) missense
R7869:C2cd3 UTSW 7 100,118,698 (GRCm39) missense probably damaging 0.99
R7999:C2cd3 UTSW 7 100,109,096 (GRCm39) critical splice donor site probably null
R8134:C2cd3 UTSW 7 100,067,711 (GRCm39) missense
R8369:C2cd3 UTSW 7 100,044,465 (GRCm39) missense probably benign 0.03
R8372:C2cd3 UTSW 7 100,104,487 (GRCm39) nonsense probably null
R8753:C2cd3 UTSW 7 100,049,024 (GRCm39) critical splice donor site probably null
R8893:C2cd3 UTSW 7 100,104,004 (GRCm39) missense probably benign
R8905:C2cd3 UTSW 7 100,074,132 (GRCm39) critical splice donor site probably null
R8945:C2cd3 UTSW 7 100,040,286 (GRCm39) missense possibly damaging 0.88
R8970:C2cd3 UTSW 7 100,068,971 (GRCm39) missense
R9000:C2cd3 UTSW 7 100,065,281 (GRCm39) missense
R9064:C2cd3 UTSW 7 100,059,608 (GRCm39) missense
R9072:C2cd3 UTSW 7 100,040,291 (GRCm39) missense probably benign 0.07
R9126:C2cd3 UTSW 7 100,081,430 (GRCm39) missense
R9160:C2cd3 UTSW 7 100,075,236 (GRCm39) missense
R9234:C2cd3 UTSW 7 100,049,012 (GRCm39) missense
R9295:C2cd3 UTSW 7 100,081,734 (GRCm39) missense
R9411:C2cd3 UTSW 7 100,065,704 (GRCm39) missense
R9420:C2cd3 UTSW 7 100,065,262 (GRCm39) missense
R9589:C2cd3 UTSW 7 100,081,756 (GRCm39) missense
R9628:C2cd3 UTSW 7 100,097,961 (GRCm39) missense
R9629:C2cd3 UTSW 7 100,029,249 (GRCm39) missense probably damaging 1.00
R9681:C2cd3 UTSW 7 100,023,662 (GRCm39) missense probably benign 0.32
R9775:C2cd3 UTSW 7 100,076,458 (GRCm39) missense
X0002:C2cd3 UTSW 7 100,089,442 (GRCm39) missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GGACAGGTCTGCAGTTTCATTTC -3'
(R):5'- AATGCACAAGACGGCTCTC -3'

Sequencing Primer
(F):5'- CAGGTCTGCAGTTTCATTTCAAGAAC -3'
(R):5'- GGCTCTCCACATAAGCTTCTAGAG -3'
Posted On 2022-03-25