Incidental Mutation 'R9258:Ctbp2'
ID 702029
Institutional Source Beutler Lab
Gene Symbol Ctbp2
Ensembl Gene ENSMUSG00000030970
Gene Name C-terminal binding protein 2
Synonyms Ribeye, D7Ertd45e, Gtrgeo6
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9258 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 132589292-132726083 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 132597021 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 119 (N119K)
Ref Sequence ENSEMBL: ENSMUSP00000127448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033269] [ENSMUST00000124096] [ENSMUST00000165457] [ENSMUST00000166439] [ENSMUST00000168958] [ENSMUST00000169570] [ENSMUST00000172341]
AlphaFold P56546
Predicted Effect probably damaging
Transcript: ENSMUST00000033269
AA Change: N144K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000033269
Gene: ENSMUSG00000030970
AA Change: N144K

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 36 358 2.9e-31 PFAM
Pfam:2-Hacid_dh_C 139 323 1.7e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165457
Predicted Effect probably damaging
Transcript: ENSMUST00000166439
AA Change: N119K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127448
Gene: ENSMUSG00000030970
AA Change: N119K

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 11 333 2.4e-31 PFAM
Pfam:2-Hacid_dh_C 114 298 1.5e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168958
AA Change: N127K

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132892
Gene: ENSMUSG00000030970
AA Change: N127K

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 19 164 6.3e-27 PFAM
Pfam:2-Hacid_dh_C 122 188 8.5e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169570
AA Change: N687K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130294
Gene: ENSMUSG00000030970
AA Change: N687K

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 579 901 2.8e-31 PFAM
Pfam:2-Hacid_dh_C 682 866 5.6e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172341
AA Change: N144K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127701
Gene: ENSMUSG00000030970
AA Change: N144K

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 36 177 5.6e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene produces alternative transcripts encoding two distinct proteins. One protein is a transcriptional repressor, while the other isoform is a major component of specialized synapses known as synaptic ribbons. Both proteins contain a NAD+ binding domain similar to NAD+-dependent 2-hydroxyacid dehydrogenases. A portion of the 3' untranslated region was used to map this gene to chromosome 21q21.3; however, it was noted that similar loci elsewhere in the genome are likely. Blast analysis shows that this gene is present on chromosome 10. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Embryos homozygous for a gene-trapped allele die by E10 exhibiting a small size, axial truncations, a thin neural epithelium, a dilated pericardium, delayed fore- and midbrain development, and defects in heart morphogenesis, placental development and extraembryonic vascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 T A 8: 124,709,347 (GRCm39) Q69L probably benign Het
Abtb2 A C 2: 103,546,410 (GRCm39) Q930P probably null Het
Adam18 G A 8: 25,158,574 (GRCm39) T73I probably benign Het
Ankrd54 A T 15: 78,946,996 (GRCm39) M1K probably null Het
Anks1 T C 17: 28,277,400 (GRCm39) V1106A probably damaging Het
Aox1 A T 1: 58,351,515 (GRCm39) I701F probably damaging Het
Arfgef3 C T 10: 18,465,387 (GRCm39) R2152H probably damaging Het
Arnt2 C T 7: 84,010,798 (GRCm39) G37E probably damaging Het
Arpp21 G A 9: 111,953,956 (GRCm39) T581M probably benign Het
Arvcf A G 16: 18,216,957 (GRCm39) N428S probably damaging Het
C2cd3 A G 7: 100,098,026 (GRCm39) E1471G Het
Cadm1 A G 9: 47,710,730 (GRCm39) K211R probably benign Het
Cdh6 A G 15: 13,064,462 (GRCm39) S143P probably damaging Het
Cep152 G A 2: 125,421,356 (GRCm39) Q1125* probably null Het
Cfap54 A C 10: 92,770,960 (GRCm39) S2095A unknown Het
Col12a1 T C 9: 79,613,645 (GRCm39) T67A probably benign Het
Col6a3 T C 1: 90,700,703 (GRCm39) N3216S unknown Het
Cpeb2 T A 5: 43,391,455 (GRCm39) L217Q Het
Des G T 1: 75,340,289 (GRCm39) V399L probably benign Het
Dnah2 G T 11: 69,368,079 (GRCm39) H1753Q probably damaging Het
Dnajc6 T C 4: 101,475,813 (GRCm39) V562A probably benign Het
Dusp13b T C 14: 21,791,155 (GRCm39) D99G probably benign Het
Ehd3 A G 17: 74,127,561 (GRCm39) I165V probably benign Het
Eme2 C T 17: 25,112,053 (GRCm39) V241M probably damaging Het
Eml5 A G 12: 98,810,376 (GRCm39) L860P possibly damaging Het
Eogt T A 6: 97,089,043 (GRCm39) K521M possibly damaging Het
Epb41l5 T C 1: 119,506,701 (GRCm39) T489A probably benign Het
Fmo5 G T 3: 97,558,802 (GRCm39) V421L probably benign Het
Gabpa C T 16: 84,653,403 (GRCm39) P268S probably benign Het
Gas2l3 G T 10: 89,262,315 (GRCm39) H136N probably benign Het
Gm5592 C T 7: 40,938,407 (GRCm39) A563V possibly damaging Het
Gpn3 A T 5: 122,519,508 (GRCm39) D205V probably benign Het
H13 T C 2: 152,522,999 (GRCm39) L104S probably damaging Het
H2-Q4 T A 17: 35,599,105 (GRCm39) V125E probably benign Het
Ifih1 A G 2: 62,442,242 (GRCm39) F374S probably damaging Het
Ildr2 A G 1: 166,131,158 (GRCm39) D338G probably damaging Het
Kmt2b A T 7: 30,281,893 (GRCm39) N1162K probably null Het
Lmntd1 T C 6: 145,359,256 (GRCm39) D298G probably damaging Het
Lrrc32 T A 7: 98,148,345 (GRCm39) V375E probably benign Het
Lrrc37a A C 11: 103,393,022 (GRCm39) I801R probably benign Het
Matcap1 A G 8: 106,008,775 (GRCm39) V414A probably damaging Het
Mgam A G 6: 40,657,121 (GRCm39) E935G probably benign Het
Mms22l A T 4: 24,588,238 (GRCm39) T917S probably damaging Het
Myo3a A T 2: 22,467,545 (GRCm39) E1204D possibly damaging Het
Nav3 T A 10: 109,550,243 (GRCm39) E1829V probably damaging Het
Nccrp1 C T 7: 28,245,632 (GRCm39) G150D probably damaging Het
Nlrp4b G T 7: 10,444,087 (GRCm39) W12L probably damaging Het
Nmb T C 7: 80,554,001 (GRCm39) T71A possibly damaging Het
Ogfod2 T A 5: 124,250,505 (GRCm39) H35Q probably benign Het
Ola1 A T 2: 72,929,732 (GRCm39) S290R probably damaging Het
Or1e30 T G 11: 73,678,281 (GRCm39) N172K probably benign Het
Or4k47 A T 2: 111,452,329 (GRCm39) I30N possibly damaging Het
Or51v15-ps1 T G 7: 103,278,543 (GRCm39) Y208S unknown Het
Or52e2 C A 7: 102,804,409 (GRCm39) E182* probably null Het
Or5p68 T G 7: 107,945,886 (GRCm39) T101P probably benign Het
Or9i14 A T 19: 13,792,099 (GRCm39) L285* probably null Het
Pcsk9 T C 4: 106,316,047 (GRCm39) D132G possibly damaging Het
Pkhd1 A T 1: 20,444,174 (GRCm39) V2296E probably damaging Het
Prl2c5 A T 13: 13,365,297 (GRCm39) I151L probably damaging Het
Prl3d3 A T 13: 27,344,931 (GRCm39) D101V possibly damaging Het
Prrt1 A G 17: 34,850,120 (GRCm39) Y178C probably damaging Het
Rasal1 A T 5: 120,793,155 (GRCm39) I87F possibly damaging Het
Rpgrip1l A T 8: 91,987,614 (GRCm39) Y814* probably null Het
Rpl3l T G 17: 24,951,447 (GRCm39) probably null Het
Rrbp1 C A 2: 143,853,161 (GRCm39) probably benign Het
Ryr3 A G 2: 112,483,364 (GRCm39) S4158P probably damaging Het
Scube2 G T 7: 109,398,515 (GRCm39) S951Y probably damaging Het
Sec14l1 T C 11: 117,041,002 (GRCm39) V396A probably benign Het
Sh3gl1 T A 17: 56,325,911 (GRCm39) K173* probably null Het
Shank3 A T 15: 89,388,521 (GRCm39) E371V probably damaging Het
Slc25a24 A G 3: 109,066,751 (GRCm39) T302A probably damaging Het
Slc25a41 A T 17: 57,348,580 (GRCm39) H4Q probably benign Het
Slc45a1 A T 4: 150,723,071 (GRCm39) V271D possibly damaging Het
Smad6 A T 9: 63,927,573 (GRCm39) L245Q probably damaging Het
Smad7 C A 18: 75,527,317 (GRCm39) Q388K probably damaging Het
Snx29 G T 16: 11,532,799 (GRCm39) D348Y possibly damaging Het
Son A T 16: 91,474,570 (GRCm39) H2418L unknown Het
Sppl3 G A 5: 115,233,922 (GRCm39) V331M probably damaging Het
St13 T G 15: 81,272,569 (GRCm39) T92P probably benign Het
St3gal4 A G 9: 34,963,643 (GRCm39) W222R probably damaging Het
Stk32a T A 18: 43,444,999 (GRCm39) N264K probably benign Het
Stoml3 T A 3: 53,405,397 (GRCm39) I26N possibly damaging Het
Taf7 T C 18: 37,776,021 (GRCm39) E182G probably damaging Het
Tas2r138 A G 6: 40,590,129 (GRCm39) V39A probably damaging Het
Tbc1d12 A G 19: 38,889,823 (GRCm39) S418G possibly damaging Het
Tbr1 T A 2: 61,642,723 (GRCm39) C663S probably benign Het
Tmc5 A T 7: 118,222,501 (GRCm39) Y67F probably benign Het
Tnfsf4 A C 1: 161,244,814 (GRCm39) I168L probably benign Het
Trav5-1 T G 14: 52,860,347 (GRCm39) S51A probably benign Het
Trmt10c A T 16: 55,854,646 (GRCm39) C330S possibly damaging Het
Trpm1 T C 7: 63,884,713 (GRCm39) M798T probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 115,958,998 (GRCm39) probably benign Het
Unc13d CATGCC CATGCCTCCGATGCC 11: 115,959,007 (GRCm39) probably benign Het
Vmn1r199 A G 13: 22,566,822 (GRCm39) T39A possibly damaging Het
Vmn1r74 T A 7: 11,580,999 (GRCm39) C100S possibly damaging Het
Vmn2r77 T A 7: 86,452,302 (GRCm39) I494K possibly damaging Het
Wdr17 G A 8: 55,112,654 (GRCm39) Q816* probably null Het
Other mutations in Ctbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02143:Ctbp2 APN 7 132,592,885 (GRCm39) missense probably damaging 0.98
IGL02615:Ctbp2 APN 7 132,597,076 (GRCm39) missense probably benign 0.34
IGL02626:Ctbp2 APN 7 132,600,940 (GRCm39) missense probably benign 0.12
PIT4802001:Ctbp2 UTSW 7 132,589,974 (GRCm39) missense possibly damaging 0.77
R0068:Ctbp2 UTSW 7 132,591,788 (GRCm39) missense possibly damaging 0.95
R0374:Ctbp2 UTSW 7 132,601,073 (GRCm39) missense possibly damaging 0.89
R0566:Ctbp2 UTSW 7 132,592,876 (GRCm39) missense probably damaging 1.00
R0571:Ctbp2 UTSW 7 132,616,534 (GRCm39) missense probably damaging 1.00
R1247:Ctbp2 UTSW 7 132,596,918 (GRCm39) missense probably benign 0.24
R1292:Ctbp2 UTSW 7 132,616,918 (GRCm39) missense probably damaging 1.00
R1477:Ctbp2 UTSW 7 132,600,670 (GRCm39) missense probably damaging 1.00
R1732:Ctbp2 UTSW 7 132,600,653 (GRCm39) missense possibly damaging 0.80
R1807:Ctbp2 UTSW 7 132,616,137 (GRCm39) missense probably benign 0.00
R1865:Ctbp2 UTSW 7 132,592,283 (GRCm39) missense probably benign 0.02
R1951:Ctbp2 UTSW 7 132,616,756 (GRCm39) missense probably benign
R2393:Ctbp2 UTSW 7 132,625,290 (GRCm39) critical splice donor site probably null
R2410:Ctbp2 UTSW 7 132,616,083 (GRCm39) missense probably benign 0.08
R3427:Ctbp2 UTSW 7 132,593,321 (GRCm39) missense probably damaging 1.00
R4004:Ctbp2 UTSW 7 132,593,502 (GRCm39) missense probably benign 0.31
R4243:Ctbp2 UTSW 7 132,600,583 (GRCm39) missense probably benign 0.43
R4754:Ctbp2 UTSW 7 132,625,287 (GRCm39) splice site probably null
R4820:Ctbp2 UTSW 7 132,615,423 (GRCm39) missense probably damaging 0.98
R4947:Ctbp2 UTSW 7 132,601,012 (GRCm39) missense probably damaging 1.00
R4960:Ctbp2 UTSW 7 132,615,967 (GRCm39) missense probably benign 0.00
R4999:Ctbp2 UTSW 7 132,616,378 (GRCm39) missense possibly damaging 0.62
R5340:Ctbp2 UTSW 7 132,615,692 (GRCm39) missense probably benign 0.43
R5593:Ctbp2 UTSW 7 132,600,598 (GRCm39) missense possibly damaging 0.95
R5762:Ctbp2 UTSW 7 132,597,088 (GRCm39) missense probably damaging 1.00
R6913:Ctbp2 UTSW 7 132,616,455 (GRCm39) missense possibly damaging 0.94
R7044:Ctbp2 UTSW 7 132,616,831 (GRCm39) missense possibly damaging 0.71
R7342:Ctbp2 UTSW 7 132,616,041 (GRCm39) missense probably damaging 0.99
R7358:Ctbp2 UTSW 7 132,600,610 (GRCm39) missense probably damaging 1.00
R7376:Ctbp2 UTSW 7 132,615,697 (GRCm39) missense possibly damaging 0.93
R7393:Ctbp2 UTSW 7 132,590,021 (GRCm39) missense probably benign 0.17
R7678:Ctbp2 UTSW 7 132,616,353 (GRCm39) missense probably benign
R7709:Ctbp2 UTSW 7 132,591,789 (GRCm39) missense probably benign
R7900:Ctbp2 UTSW 7 132,616,328 (GRCm39) missense probably benign
R8018:Ctbp2 UTSW 7 132,616,095 (GRCm39) missense probably benign 0.38
R9185:Ctbp2 UTSW 7 132,615,712 (GRCm39) missense probably damaging 0.97
R9294:Ctbp2 UTSW 7 132,615,961 (GRCm39) missense probably damaging 0.96
R9326:Ctbp2 UTSW 7 132,616,359 (GRCm39) missense probably benign
R9385:Ctbp2 UTSW 7 132,601,069 (GRCm39) missense probably benign 0.14
R9576:Ctbp2 UTSW 7 132,616,198 (GRCm39) missense probably benign 0.00
R9652:Ctbp2 UTSW 7 132,615,933 (GRCm39) missense probably damaging 1.00
R9653:Ctbp2 UTSW 7 132,615,933 (GRCm39) missense probably damaging 1.00
Z1176:Ctbp2 UTSW 7 132,617,019 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- TCTTGTAGAACAGGCTCGGATC -3'
(R):5'- AGCTTCAGAAACAAGTCTGCTG -3'

Sequencing Primer
(F):5'- GAACAGGCTCGGATCATATCTCTG -3'
(R):5'- ACAAGTCTGCTGAATACACTGG -3'
Posted On 2022-03-25