Incidental Mutation 'R0747:Olfr720'
ID70203
Institutional Source Beutler Lab
Gene Symbol Olfr720
Ensembl Gene ENSMUSG00000052417
Gene Nameolfactory receptor 720
SynonymsMOR274-2, GA_x6K02T2PLTE-6544896-6543946
MMRRC Submission 038928-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R0747 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location14171738-14186838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 14175429 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 218 (A218T)
Ref Sequence ENSEMBL: ENSMUSP00000149641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035250] [ENSMUST00000206298] [ENSMUST00000216079] [ENSMUST00000217642]
Predicted Effect probably benign
Transcript: ENSMUST00000035250
AA Change: A218T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000046509
Gene: ENSMUSG00000052417
AA Change: A218T

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 8.4e-49 PFAM
Pfam:7tm_1 40 289 8.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206298
AA Change: A218T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000216079
AA Change: A218T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000217642
AA Change: A218T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830406C13Rik T A 14: 12,287,287 M16K probably benign Het
Adam19 A T 11: 46,118,495 probably null Het
Anks4b C T 7: 120,182,163 A139V probably damaging Het
Arf1 G A 11: 59,212,635 R149C probably benign Het
Axl A T 7: 25,764,059 C598S possibly damaging Het
B3gnt2 T C 11: 22,836,316 I291V possibly damaging Het
Ccdc158 T A 5: 92,633,297 H883L probably benign Het
Col6a3 A G 1: 90,802,653 S1644P probably damaging Het
Cspg4 T C 9: 56,890,280 S1343P probably damaging Het
D430041D05Rik G T 2: 104,230,306 H1414Q probably damaging Het
Dnah5 C G 15: 28,444,186 I4043M probably damaging Het
Dnah5 T A 15: 28,444,187 C4044S possibly damaging Het
Dpep3 C T 8: 105,977,386 A267T probably benign Het
Dync1h1 A C 12: 110,612,411 H106P probably benign Het
Dync1h1 A C 12: 110,629,284 E1466A probably damaging Het
Fggy T C 4: 95,812,100 probably benign Het
Frmd6 A G 12: 70,864,056 T5A probably benign Het
Gnb5 G A 9: 75,311,470 V26I probably benign Het
Hephl1 A T 9: 15,054,001 probably benign Het
Hmmr C T 11: 40,721,745 probably benign Het
Hpn A T 7: 31,099,546 F356Y probably damaging Het
Iqgap3 T C 3: 88,107,503 probably benign Het
Ism2 A G 12: 87,285,398 probably benign Het
Kansl1 T A 11: 104,342,976 M754L probably benign Het
Kcnc4 A T 3: 107,448,154 I326N probably damaging Het
Lcn6 G A 2: 25,677,172 V62M probably damaging Het
Lrp1b A T 2: 40,870,341 C2858S probably damaging Het
Lyn G A 4: 3,745,638 probably benign Het
Mov10 T A 3: 104,802,496 H358L probably benign Het
Notch1 A G 2: 26,472,140 V60A unknown Het
Pgap2 C A 7: 102,237,136 Y176* probably null Het
Pglyrp1 A G 7: 18,890,275 Q161R possibly damaging Het
Plod3 A G 5: 136,988,195 N66S probably benign Het
Psmc3 A G 2: 91,054,300 E18G probably benign Het
Psme3 T G 11: 101,317,046 M9R probably benign Het
Rapgef4 A G 2: 72,223,073 N428S possibly damaging Het
Rbp3 A G 14: 33,956,278 I728V possibly damaging Het
Sall4 A T 2: 168,754,966 H651Q probably damaging Het
Skint3 T A 4: 112,253,905 Y76N probably damaging Het
Slc13a4 T C 6: 35,278,328 T342A probably damaging Het
Slc25a1 G T 16: 17,926,220 T239K probably damaging Het
Slc36a2 T A 11: 55,169,859 I242F probably benign Het
Tekt2 G A 4: 126,323,760 Q171* probably null Het
Tet2 T G 3: 133,467,470 H1677P possibly damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trcg1 C T 9: 57,241,921 P259S probably benign Het
Ttn A C 2: 76,710,598 S25688A probably damaging Het
Vmn2r117 T A 17: 23,475,503 R457* probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Other mutations in Olfr720
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02658:Olfr720 APN 14 14175732 missense possibly damaging 0.92
IGL02704:Olfr720 APN 14 14175483 missense probably benign 0.00
IGL03308:Olfr720 APN 14 14175161 missense probably benign
IGL03331:Olfr720 APN 14 14176017 missense probably benign 0.16
R0008:Olfr720 UTSW 14 14176092 start gained probably benign
R0131:Olfr720 UTSW 14 14175620 missense probably benign 0.03
R0647:Olfr720 UTSW 14 14175858 missense probably benign 0.35
R1210:Olfr720 UTSW 14 14176029 missense probably benign 0.00
R1225:Olfr720 UTSW 14 14175600 missense possibly damaging 0.89
R1525:Olfr720 UTSW 14 14175725 missense probably damaging 1.00
R1975:Olfr720 UTSW 14 14175446 missense probably damaging 1.00
R1994:Olfr720 UTSW 14 14175854 missense probably benign 0.16
R2310:Olfr720 UTSW 14 14175836 missense probably benign 0.03
R3151:Olfr720 UTSW 14 14175203 missense probably damaging 1.00
R4547:Olfr720 UTSW 14 14175854 missense probably damaging 0.99
R4824:Olfr720 UTSW 14 14175885 missense probably damaging 1.00
R5063:Olfr720 UTSW 14 14175593 missense probably damaging 1.00
R5098:Olfr720 UTSW 14 14175683 missense probably benign 0.03
R5430:Olfr720 UTSW 14 14175692 missense probably benign 0.03
R5512:Olfr720 UTSW 14 14175633 missense probably damaging 1.00
R5748:Olfr720 UTSW 14 14175314 missense probably damaging 1.00
R7200:Olfr720 UTSW 14 14175477 missense probably damaging 1.00
R7407:Olfr720 UTSW 14 14175402 missense probably benign
R7666:Olfr720 UTSW 14 14176075 missense probably benign
R7760:Olfr720 UTSW 14 14175905 missense probably damaging 1.00
R8118:Olfr720 UTSW 14 14175863 missense probably damaging 1.00
R8413:Olfr720 UTSW 14 14175416 missense probably benign 0.00
R8873:Olfr720 UTSW 14 14175344 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATCCCAGACAGGCAGAAGTGTG -3'
(R):5'- GGGCTTTGGACAGTTTCCTTCTCAC -3'

Sequencing Primer
(F):5'- CCTCAGACTATAAATAACAGGGTTG -3'
(R):5'- TCACTCCCATCACCATGAGTC -3'
Posted On2013-09-30