Incidental Mutation 'R9258:Rpgrip1l'
ID 702032
Institutional Source Beutler Lab
Gene Symbol Rpgrip1l
Ensembl Gene ENSMUSG00000033282
Gene Name Rpgrip1-like
Synonyms Nphp8, 1700047E16Rik, Ftm, fantom
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9258 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 91943658-92039890 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 91987614 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 814 (Y814*)
Ref Sequence ENSEMBL: ENSMUSP00000042702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047783] [ENSMUST00000139113] [ENSMUST00000209616]
AlphaFold Q8CG73
Predicted Effect probably null
Transcript: ENSMUST00000047783
AA Change: Y814*
SMART Domains Protein: ENSMUSP00000042702
Gene: ENSMUSG00000033282
AA Change: Y814*

DomainStartEndE-ValueType
coiled coil region 56 143 N/A INTRINSIC
coiled coil region 196 268 N/A INTRINSIC
coiled coil region 299 371 N/A INTRINSIC
coiled coil region 395 454 N/A INTRINSIC
coiled coil region 520 556 N/A INTRINSIC
Pfam:C2-C2_1 597 738 5.8e-61 PFAM
low complexity region 769 778 N/A INTRINSIC
C2 791 896 1.06e-5 SMART
low complexity region 989 1000 N/A INTRINSIC
low complexity region 1057 1080 N/A INTRINSIC
Blast:C2 1098 1223 3e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000139113
SMART Domains Protein: ENSMUSP00000118230
Gene: ENSMUSG00000033282

DomainStartEndE-ValueType
coiled coil region 56 143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209616
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can localize to the basal body-centrosome complex or to primary cilia and centrosomes in ciliated cells. The encoded protein has been found to interact with nephrocystin-4. Defects in this gene are a cause of Joubert syndrome type 7 (JBTS7) and Meckel syndrome type 5 (MKS5). [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a knock-out allele do not survive after birth and show exencephaly, polydactyly, laterality defects, abnormal floor plate induction and neural tube patterning, cleft lip, micro- and anophthalmia, and variable cerebral, renal, and hepatic defects due to primary cilium dysfuntion. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 T A 8: 124,709,347 (GRCm39) Q69L probably benign Het
Abtb2 A C 2: 103,546,410 (GRCm39) Q930P probably null Het
Adam18 G A 8: 25,158,574 (GRCm39) T73I probably benign Het
Ankrd54 A T 15: 78,946,996 (GRCm39) M1K probably null Het
Anks1 T C 17: 28,277,400 (GRCm39) V1106A probably damaging Het
Aox1 A T 1: 58,351,515 (GRCm39) I701F probably damaging Het
Arfgef3 C T 10: 18,465,387 (GRCm39) R2152H probably damaging Het
Arnt2 C T 7: 84,010,798 (GRCm39) G37E probably damaging Het
Arpp21 G A 9: 111,953,956 (GRCm39) T581M probably benign Het
Arvcf A G 16: 18,216,957 (GRCm39) N428S probably damaging Het
C2cd3 A G 7: 100,098,026 (GRCm39) E1471G Het
Cadm1 A G 9: 47,710,730 (GRCm39) K211R probably benign Het
Cdh6 A G 15: 13,064,462 (GRCm39) S143P probably damaging Het
Cep152 G A 2: 125,421,356 (GRCm39) Q1125* probably null Het
Cfap54 A C 10: 92,770,960 (GRCm39) S2095A unknown Het
Col12a1 T C 9: 79,613,645 (GRCm39) T67A probably benign Het
Col6a3 T C 1: 90,700,703 (GRCm39) N3216S unknown Het
Cpeb2 T A 5: 43,391,455 (GRCm39) L217Q Het
Ctbp2 A T 7: 132,597,021 (GRCm39) N119K probably damaging Het
Des G T 1: 75,340,289 (GRCm39) V399L probably benign Het
Dnah2 G T 11: 69,368,079 (GRCm39) H1753Q probably damaging Het
Dnajc6 T C 4: 101,475,813 (GRCm39) V562A probably benign Het
Dusp13b T C 14: 21,791,155 (GRCm39) D99G probably benign Het
Ehd3 A G 17: 74,127,561 (GRCm39) I165V probably benign Het
Eme2 C T 17: 25,112,053 (GRCm39) V241M probably damaging Het
Eml5 A G 12: 98,810,376 (GRCm39) L860P possibly damaging Het
Eogt T A 6: 97,089,043 (GRCm39) K521M possibly damaging Het
Epb41l5 T C 1: 119,506,701 (GRCm39) T489A probably benign Het
Fmo5 G T 3: 97,558,802 (GRCm39) V421L probably benign Het
Gabpa C T 16: 84,653,403 (GRCm39) P268S probably benign Het
Gas2l3 G T 10: 89,262,315 (GRCm39) H136N probably benign Het
Gm5592 C T 7: 40,938,407 (GRCm39) A563V possibly damaging Het
Gpn3 A T 5: 122,519,508 (GRCm39) D205V probably benign Het
H13 T C 2: 152,522,999 (GRCm39) L104S probably damaging Het
H2-Q4 T A 17: 35,599,105 (GRCm39) V125E probably benign Het
Ifih1 A G 2: 62,442,242 (GRCm39) F374S probably damaging Het
Ildr2 A G 1: 166,131,158 (GRCm39) D338G probably damaging Het
Kmt2b A T 7: 30,281,893 (GRCm39) N1162K probably null Het
Lmntd1 T C 6: 145,359,256 (GRCm39) D298G probably damaging Het
Lrrc32 T A 7: 98,148,345 (GRCm39) V375E probably benign Het
Lrrc37a A C 11: 103,393,022 (GRCm39) I801R probably benign Het
Matcap1 A G 8: 106,008,775 (GRCm39) V414A probably damaging Het
Mgam A G 6: 40,657,121 (GRCm39) E935G probably benign Het
Mms22l A T 4: 24,588,238 (GRCm39) T917S probably damaging Het
Myo3a A T 2: 22,467,545 (GRCm39) E1204D possibly damaging Het
Nav3 T A 10: 109,550,243 (GRCm39) E1829V probably damaging Het
Nccrp1 C T 7: 28,245,632 (GRCm39) G150D probably damaging Het
Nlrp4b G T 7: 10,444,087 (GRCm39) W12L probably damaging Het
Nmb T C 7: 80,554,001 (GRCm39) T71A possibly damaging Het
Ogfod2 T A 5: 124,250,505 (GRCm39) H35Q probably benign Het
Ola1 A T 2: 72,929,732 (GRCm39) S290R probably damaging Het
Or1e30 T G 11: 73,678,281 (GRCm39) N172K probably benign Het
Or4k47 A T 2: 111,452,329 (GRCm39) I30N possibly damaging Het
Or51v15-ps1 T G 7: 103,278,543 (GRCm39) Y208S unknown Het
Or52e2 C A 7: 102,804,409 (GRCm39) E182* probably null Het
Or5p68 T G 7: 107,945,886 (GRCm39) T101P probably benign Het
Or9i14 A T 19: 13,792,099 (GRCm39) L285* probably null Het
Pcsk9 T C 4: 106,316,047 (GRCm39) D132G possibly damaging Het
Pkhd1 A T 1: 20,444,174 (GRCm39) V2296E probably damaging Het
Prl2c5 A T 13: 13,365,297 (GRCm39) I151L probably damaging Het
Prl3d3 A T 13: 27,344,931 (GRCm39) D101V possibly damaging Het
Prrt1 A G 17: 34,850,120 (GRCm39) Y178C probably damaging Het
Rasal1 A T 5: 120,793,155 (GRCm39) I87F possibly damaging Het
Rpl3l T G 17: 24,951,447 (GRCm39) probably null Het
Rrbp1 C A 2: 143,853,161 (GRCm39) probably benign Het
Ryr3 A G 2: 112,483,364 (GRCm39) S4158P probably damaging Het
Scube2 G T 7: 109,398,515 (GRCm39) S951Y probably damaging Het
Sec14l1 T C 11: 117,041,002 (GRCm39) V396A probably benign Het
Sh3gl1 T A 17: 56,325,911 (GRCm39) K173* probably null Het
Shank3 A T 15: 89,388,521 (GRCm39) E371V probably damaging Het
Slc25a24 A G 3: 109,066,751 (GRCm39) T302A probably damaging Het
Slc25a41 A T 17: 57,348,580 (GRCm39) H4Q probably benign Het
Slc45a1 A T 4: 150,723,071 (GRCm39) V271D possibly damaging Het
Smad6 A T 9: 63,927,573 (GRCm39) L245Q probably damaging Het
Smad7 C A 18: 75,527,317 (GRCm39) Q388K probably damaging Het
Snx29 G T 16: 11,532,799 (GRCm39) D348Y possibly damaging Het
Son A T 16: 91,474,570 (GRCm39) H2418L unknown Het
Sppl3 G A 5: 115,233,922 (GRCm39) V331M probably damaging Het
St13 T G 15: 81,272,569 (GRCm39) T92P probably benign Het
St3gal4 A G 9: 34,963,643 (GRCm39) W222R probably damaging Het
Stk32a T A 18: 43,444,999 (GRCm39) N264K probably benign Het
Stoml3 T A 3: 53,405,397 (GRCm39) I26N possibly damaging Het
Taf7 T C 18: 37,776,021 (GRCm39) E182G probably damaging Het
Tas2r138 A G 6: 40,590,129 (GRCm39) V39A probably damaging Het
Tbc1d12 A G 19: 38,889,823 (GRCm39) S418G possibly damaging Het
Tbr1 T A 2: 61,642,723 (GRCm39) C663S probably benign Het
Tmc5 A T 7: 118,222,501 (GRCm39) Y67F probably benign Het
Tnfsf4 A C 1: 161,244,814 (GRCm39) I168L probably benign Het
Trav5-1 T G 14: 52,860,347 (GRCm39) S51A probably benign Het
Trmt10c A T 16: 55,854,646 (GRCm39) C330S possibly damaging Het
Trpm1 T C 7: 63,884,713 (GRCm39) M798T probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 115,958,998 (GRCm39) probably benign Het
Unc13d CATGCC CATGCCTCCGATGCC 11: 115,959,007 (GRCm39) probably benign Het
Vmn1r199 A G 13: 22,566,822 (GRCm39) T39A possibly damaging Het
Vmn1r74 T A 7: 11,580,999 (GRCm39) C100S possibly damaging Het
Vmn2r77 T A 7: 86,452,302 (GRCm39) I494K possibly damaging Het
Wdr17 G A 8: 55,112,654 (GRCm39) Q816* probably null Het
Other mutations in Rpgrip1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rpgrip1l APN 8 91,990,202 (GRCm39) missense possibly damaging 0.52
IGL00932:Rpgrip1l APN 8 92,002,265 (GRCm39) missense probably benign 0.33
IGL01113:Rpgrip1l APN 8 91,987,367 (GRCm39) intron probably benign
IGL01151:Rpgrip1l APN 8 92,001,777 (GRCm39) missense probably damaging 1.00
IGL01321:Rpgrip1l APN 8 91,987,501 (GRCm39) nonsense probably null
IGL01384:Rpgrip1l APN 8 92,000,268 (GRCm39) missense probably benign 0.00
IGL01634:Rpgrip1l APN 8 91,979,172 (GRCm39) missense probably benign 0.25
IGL01634:Rpgrip1l APN 8 91,979,171 (GRCm39) missense probably benign
IGL01781:Rpgrip1l APN 8 91,996,846 (GRCm39) missense probably benign 0.16
IGL01784:Rpgrip1l APN 8 91,997,089 (GRCm39) missense possibly damaging 0.56
IGL02034:Rpgrip1l APN 8 91,977,776 (GRCm39) critical splice donor site probably null
IGL02250:Rpgrip1l APN 8 91,959,489 (GRCm39) missense probably benign 0.00
IGL02285:Rpgrip1l APN 8 91,959,535 (GRCm39) missense possibly damaging 0.92
IGL02634:Rpgrip1l APN 8 91,951,972 (GRCm39) splice site probably benign
IGL02736:Rpgrip1l APN 8 91,990,219 (GRCm39) missense possibly damaging 0.91
IGL02825:Rpgrip1l APN 8 92,031,433 (GRCm39) missense possibly damaging 0.67
IGL02962:Rpgrip1l APN 8 91,996,990 (GRCm39) missense possibly damaging 0.95
IGL03031:Rpgrip1l APN 8 91,987,411 (GRCm39) missense probably damaging 1.00
IGL03184:Rpgrip1l APN 8 92,027,437 (GRCm39) missense probably damaging 1.00
P0005:Rpgrip1l UTSW 8 92,025,853 (GRCm39) splice site probably benign
R0118:Rpgrip1l UTSW 8 91,996,750 (GRCm39) missense probably damaging 1.00
R0490:Rpgrip1l UTSW 8 92,026,473 (GRCm39) splice site probably benign
R0599:Rpgrip1l UTSW 8 92,031,628 (GRCm39) missense probably damaging 1.00
R1514:Rpgrip1l UTSW 8 91,987,378 (GRCm39) missense probably damaging 1.00
R1648:Rpgrip1l UTSW 8 91,979,517 (GRCm39) missense probably damaging 1.00
R1914:Rpgrip1l UTSW 8 91,959,552 (GRCm39) missense probably benign 0.13
R1915:Rpgrip1l UTSW 8 91,959,552 (GRCm39) missense probably benign 0.13
R2093:Rpgrip1l UTSW 8 91,996,760 (GRCm39) missense possibly damaging 0.87
R2225:Rpgrip1l UTSW 8 91,948,095 (GRCm39) missense probably benign 0.45
R2504:Rpgrip1l UTSW 8 92,007,344 (GRCm39) critical splice donor site probably null
R3859:Rpgrip1l UTSW 8 91,990,286 (GRCm39) missense probably benign 0.00
R4118:Rpgrip1l UTSW 8 91,979,535 (GRCm39) missense probably benign
R4801:Rpgrip1l UTSW 8 91,996,805 (GRCm39) missense probably damaging 1.00
R4802:Rpgrip1l UTSW 8 91,996,805 (GRCm39) missense probably damaging 1.00
R4921:Rpgrip1l UTSW 8 91,987,637 (GRCm39) missense probably benign 0.05
R4976:Rpgrip1l UTSW 8 92,007,444 (GRCm39) missense probably damaging 1.00
R5092:Rpgrip1l UTSW 8 91,948,012 (GRCm39) nonsense probably null
R5099:Rpgrip1l UTSW 8 91,975,350 (GRCm39) missense probably benign 0.20
R5119:Rpgrip1l UTSW 8 92,007,444 (GRCm39) missense probably damaging 1.00
R5141:Rpgrip1l UTSW 8 91,987,546 (GRCm39) missense probably benign 0.29
R5793:Rpgrip1l UTSW 8 91,987,400 (GRCm39) missense probably benign 0.06
R5847:Rpgrip1l UTSW 8 92,031,613 (GRCm39) missense probably damaging 1.00
R5871:Rpgrip1l UTSW 8 91,948,014 (GRCm39) missense possibly damaging 0.89
R5916:Rpgrip1l UTSW 8 91,979,541 (GRCm39) missense possibly damaging 0.93
R6619:Rpgrip1l UTSW 8 91,959,499 (GRCm39) missense possibly damaging 0.69
R6654:Rpgrip1l UTSW 8 91,946,833 (GRCm39) missense probably benign 0.36
R6956:Rpgrip1l UTSW 8 92,012,941 (GRCm39) splice site probably null
R6984:Rpgrip1l UTSW 8 91,987,426 (GRCm39) missense probably benign 0.03
R7064:Rpgrip1l UTSW 8 91,990,148 (GRCm39) nonsense probably null
R7145:Rpgrip1l UTSW 8 91,959,434 (GRCm39) critical splice donor site probably null
R7243:Rpgrip1l UTSW 8 91,996,751 (GRCm39) missense probably benign 0.00
R7673:Rpgrip1l UTSW 8 92,027,415 (GRCm39) missense possibly damaging 0.89
R7796:Rpgrip1l UTSW 8 91,996,865 (GRCm39) missense probably damaging 1.00
R8684:Rpgrip1l UTSW 8 92,000,329 (GRCm39) missense probably benign 0.00
R8769:Rpgrip1l UTSW 8 91,979,212 (GRCm39) splice site probably benign
R8955:Rpgrip1l UTSW 8 92,007,456 (GRCm39) missense possibly damaging 0.67
R9006:Rpgrip1l UTSW 8 92,007,436 (GRCm39) missense probably benign
R9085:Rpgrip1l UTSW 8 92,014,303 (GRCm39) missense possibly damaging 0.68
R9188:Rpgrip1l UTSW 8 92,031,638 (GRCm39) missense probably damaging 1.00
R9268:Rpgrip1l UTSW 8 92,007,355 (GRCm39) missense probably benign
R9366:Rpgrip1l UTSW 8 91,996,809 (GRCm39) nonsense probably null
R9547:Rpgrip1l UTSW 8 91,977,873 (GRCm39) missense probably benign 0.00
R9565:Rpgrip1l UTSW 8 92,031,516 (GRCm39) missense probably benign 0.05
R9582:Rpgrip1l UTSW 8 91,996,886 (GRCm39) missense probably benign 0.03
R9604:Rpgrip1l UTSW 8 92,031,433 (GRCm39) missense possibly damaging 0.67
R9614:Rpgrip1l UTSW 8 91,987,434 (GRCm39) missense possibly damaging 0.79
R9697:Rpgrip1l UTSW 8 91,987,391 (GRCm39) missense possibly damaging 0.49
Z1088:Rpgrip1l UTSW 8 91,996,748 (GRCm39) missense possibly damaging 0.89
Z1088:Rpgrip1l UTSW 8 91,987,603 (GRCm39) missense possibly damaging 0.96
Z1088:Rpgrip1l UTSW 8 91,946,807 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- AGAGGCACATTGACTTTTCCC -3'
(R):5'- GAGGTTGGAAGCTGATAGTTACC -3'

Sequencing Primer
(F):5'- TCCCATGTAAATATTCTCCTGGG -3'
(R):5'- TGGAAGCTGATAGTTACCTTTAATTG -3'
Posted On 2022-03-25