Incidental Mutation 'R9258:St3gal4'
ID 702035
Institutional Source Beutler Lab
Gene Symbol St3gal4
Ensembl Gene ENSMUSG00000032038
Gene Name ST3 beta-galactoside alpha-2,3-sialyltransferase 4
Synonyms ST3Gal IV, Siat4c
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R9258 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 34957872-35028160 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34963643 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 222 (W222R)
Ref Sequence ENSEMBL: ENSMUSP00000034537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034537] [ENSMUST00000213526] [ENSMUST00000214526] [ENSMUST00000215089] [ENSMUST00000215463] [ENSMUST00000215638] [ENSMUST00000216557] [ENSMUST00000217149] [ENSMUST00000217542]
AlphaFold Q91Y74
Predicted Effect probably damaging
Transcript: ENSMUST00000034537
AA Change: W222R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034537
Gene: ENSMUSG00000032038
AA Change: W222R

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glyco_transf_29 70 332 4.1e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213526
Predicted Effect probably benign
Transcript: ENSMUST00000214526
Predicted Effect probably benign
Transcript: ENSMUST00000215089
Predicted Effect probably benign
Transcript: ENSMUST00000215463
Predicted Effect probably benign
Transcript: ENSMUST00000215638
Predicted Effect probably benign
Transcript: ENSMUST00000216557
Predicted Effect probably benign
Transcript: ENSMUST00000217149
Predicted Effect probably benign
Transcript: ENSMUST00000217542
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 29 family, a group of enzymes involved in protein glycosylation. The encoded protein is targeted to Golgi membranes but may be proteolytically processed and secreted. The gene product may also be involved in the increased expression of sialyl Lewis X antigen seen in inflammatory responses. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygotes for a null allele show thrombocytopenia, altered platelet physiology, increased bleeding times, and abnormal leukocyte migration. Homozygotes for a different null allele fail to develop seizures in response to kindling, and show anxiety-like behaviors and altered sleep patterns. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 T A 8: 124,709,347 (GRCm39) Q69L probably benign Het
Abtb2 A C 2: 103,546,410 (GRCm39) Q930P probably null Het
Adam18 G A 8: 25,158,574 (GRCm39) T73I probably benign Het
Ankrd54 A T 15: 78,946,996 (GRCm39) M1K probably null Het
Anks1 T C 17: 28,277,400 (GRCm39) V1106A probably damaging Het
Aox1 A T 1: 58,351,515 (GRCm39) I701F probably damaging Het
Arfgef3 C T 10: 18,465,387 (GRCm39) R2152H probably damaging Het
Arnt2 C T 7: 84,010,798 (GRCm39) G37E probably damaging Het
Arpp21 G A 9: 111,953,956 (GRCm39) T581M probably benign Het
Arvcf A G 16: 18,216,957 (GRCm39) N428S probably damaging Het
C2cd3 A G 7: 100,098,026 (GRCm39) E1471G Het
Cadm1 A G 9: 47,710,730 (GRCm39) K211R probably benign Het
Cdh6 A G 15: 13,064,462 (GRCm39) S143P probably damaging Het
Cep152 G A 2: 125,421,356 (GRCm39) Q1125* probably null Het
Cfap54 A C 10: 92,770,960 (GRCm39) S2095A unknown Het
Col12a1 T C 9: 79,613,645 (GRCm39) T67A probably benign Het
Col6a3 T C 1: 90,700,703 (GRCm39) N3216S unknown Het
Cpeb2 T A 5: 43,391,455 (GRCm39) L217Q Het
Ctbp2 A T 7: 132,597,021 (GRCm39) N119K probably damaging Het
Des G T 1: 75,340,289 (GRCm39) V399L probably benign Het
Dnah2 G T 11: 69,368,079 (GRCm39) H1753Q probably damaging Het
Dnajc6 T C 4: 101,475,813 (GRCm39) V562A probably benign Het
Dusp13b T C 14: 21,791,155 (GRCm39) D99G probably benign Het
Ehd3 A G 17: 74,127,561 (GRCm39) I165V probably benign Het
Eme2 C T 17: 25,112,053 (GRCm39) V241M probably damaging Het
Eml5 A G 12: 98,810,376 (GRCm39) L860P possibly damaging Het
Eogt T A 6: 97,089,043 (GRCm39) K521M possibly damaging Het
Epb41l5 T C 1: 119,506,701 (GRCm39) T489A probably benign Het
Fmo5 G T 3: 97,558,802 (GRCm39) V421L probably benign Het
Gabpa C T 16: 84,653,403 (GRCm39) P268S probably benign Het
Gas2l3 G T 10: 89,262,315 (GRCm39) H136N probably benign Het
Gm5592 C T 7: 40,938,407 (GRCm39) A563V possibly damaging Het
Gpn3 A T 5: 122,519,508 (GRCm39) D205V probably benign Het
H13 T C 2: 152,522,999 (GRCm39) L104S probably damaging Het
H2-Q4 T A 17: 35,599,105 (GRCm39) V125E probably benign Het
Ifih1 A G 2: 62,442,242 (GRCm39) F374S probably damaging Het
Ildr2 A G 1: 166,131,158 (GRCm39) D338G probably damaging Het
Kmt2b A T 7: 30,281,893 (GRCm39) N1162K probably null Het
Lmntd1 T C 6: 145,359,256 (GRCm39) D298G probably damaging Het
Lrrc32 T A 7: 98,148,345 (GRCm39) V375E probably benign Het
Lrrc37a A C 11: 103,393,022 (GRCm39) I801R probably benign Het
Matcap1 A G 8: 106,008,775 (GRCm39) V414A probably damaging Het
Mgam A G 6: 40,657,121 (GRCm39) E935G probably benign Het
Mms22l A T 4: 24,588,238 (GRCm39) T917S probably damaging Het
Myo3a A T 2: 22,467,545 (GRCm39) E1204D possibly damaging Het
Nav3 T A 10: 109,550,243 (GRCm39) E1829V probably damaging Het
Nccrp1 C T 7: 28,245,632 (GRCm39) G150D probably damaging Het
Nlrp4b G T 7: 10,444,087 (GRCm39) W12L probably damaging Het
Nmb T C 7: 80,554,001 (GRCm39) T71A possibly damaging Het
Ogfod2 T A 5: 124,250,505 (GRCm39) H35Q probably benign Het
Ola1 A T 2: 72,929,732 (GRCm39) S290R probably damaging Het
Or1e30 T G 11: 73,678,281 (GRCm39) N172K probably benign Het
Or4k47 A T 2: 111,452,329 (GRCm39) I30N possibly damaging Het
Or51v15-ps1 T G 7: 103,278,543 (GRCm39) Y208S unknown Het
Or52e2 C A 7: 102,804,409 (GRCm39) E182* probably null Het
Or5p68 T G 7: 107,945,886 (GRCm39) T101P probably benign Het
Or9i14 A T 19: 13,792,099 (GRCm39) L285* probably null Het
Pcsk9 T C 4: 106,316,047 (GRCm39) D132G possibly damaging Het
Pkhd1 A T 1: 20,444,174 (GRCm39) V2296E probably damaging Het
Prl2c5 A T 13: 13,365,297 (GRCm39) I151L probably damaging Het
Prl3d3 A T 13: 27,344,931 (GRCm39) D101V possibly damaging Het
Prrt1 A G 17: 34,850,120 (GRCm39) Y178C probably damaging Het
Rasal1 A T 5: 120,793,155 (GRCm39) I87F possibly damaging Het
Rpgrip1l A T 8: 91,987,614 (GRCm39) Y814* probably null Het
Rpl3l T G 17: 24,951,447 (GRCm39) probably null Het
Rrbp1 C A 2: 143,853,161 (GRCm39) probably benign Het
Ryr3 A G 2: 112,483,364 (GRCm39) S4158P probably damaging Het
Scube2 G T 7: 109,398,515 (GRCm39) S951Y probably damaging Het
Sec14l1 T C 11: 117,041,002 (GRCm39) V396A probably benign Het
Sh3gl1 T A 17: 56,325,911 (GRCm39) K173* probably null Het
Shank3 A T 15: 89,388,521 (GRCm39) E371V probably damaging Het
Slc25a24 A G 3: 109,066,751 (GRCm39) T302A probably damaging Het
Slc25a41 A T 17: 57,348,580 (GRCm39) H4Q probably benign Het
Slc45a1 A T 4: 150,723,071 (GRCm39) V271D possibly damaging Het
Smad6 A T 9: 63,927,573 (GRCm39) L245Q probably damaging Het
Smad7 C A 18: 75,527,317 (GRCm39) Q388K probably damaging Het
Snx29 G T 16: 11,532,799 (GRCm39) D348Y possibly damaging Het
Son A T 16: 91,474,570 (GRCm39) H2418L unknown Het
Sppl3 G A 5: 115,233,922 (GRCm39) V331M probably damaging Het
St13 T G 15: 81,272,569 (GRCm39) T92P probably benign Het
Stk32a T A 18: 43,444,999 (GRCm39) N264K probably benign Het
Stoml3 T A 3: 53,405,397 (GRCm39) I26N possibly damaging Het
Taf7 T C 18: 37,776,021 (GRCm39) E182G probably damaging Het
Tas2r138 A G 6: 40,590,129 (GRCm39) V39A probably damaging Het
Tbc1d12 A G 19: 38,889,823 (GRCm39) S418G possibly damaging Het
Tbr1 T A 2: 61,642,723 (GRCm39) C663S probably benign Het
Tmc5 A T 7: 118,222,501 (GRCm39) Y67F probably benign Het
Tnfsf4 A C 1: 161,244,814 (GRCm39) I168L probably benign Het
Trav5-1 T G 14: 52,860,347 (GRCm39) S51A probably benign Het
Trmt10c A T 16: 55,854,646 (GRCm39) C330S possibly damaging Het
Trpm1 T C 7: 63,884,713 (GRCm39) M798T probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 115,958,998 (GRCm39) probably benign Het
Unc13d CATGCC CATGCCTCCGATGCC 11: 115,959,007 (GRCm39) probably benign Het
Vmn1r199 A G 13: 22,566,822 (GRCm39) T39A possibly damaging Het
Vmn1r74 T A 7: 11,580,999 (GRCm39) C100S possibly damaging Het
Vmn2r77 T A 7: 86,452,302 (GRCm39) I494K possibly damaging Het
Wdr17 G A 8: 55,112,654 (GRCm39) Q816* probably null Het
Other mutations in St3gal4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:St3gal4 APN 9 34,964,365 (GRCm39) unclassified probably benign
IGL01448:St3gal4 APN 9 34,963,627 (GRCm39) missense probably benign 0.00
IGL01770:St3gal4 APN 9 34,963,601 (GRCm39) missense possibly damaging 0.73
IGL02862:St3gal4 APN 9 34,963,543 (GRCm39) missense probably benign 0.32
fuji UTSW 9 34,964,469 (GRCm39) nonsense probably null
Granny_smith UTSW 9 34,964,558 (GRCm39) missense probably damaging 1.00
Pomology UTSW 9 34,964,375 (GRCm39) missense possibly damaging 0.67
R0362:St3gal4 UTSW 9 34,964,469 (GRCm39) nonsense probably null
R0863:St3gal4 UTSW 9 34,964,744 (GRCm39) missense probably damaging 1.00
R1457:St3gal4 UTSW 9 34,966,053 (GRCm39) missense possibly damaging 0.66
R1530:St3gal4 UTSW 9 34,963,592 (GRCm39) missense probably benign 0.00
R4991:St3gal4 UTSW 9 34,964,432 (GRCm39) missense possibly damaging 0.93
R5452:St3gal4 UTSW 9 34,964,752 (GRCm39) missense probably damaging 1.00
R6277:St3gal4 UTSW 9 34,964,558 (GRCm39) missense probably damaging 1.00
R7564:St3gal4 UTSW 9 34,963,549 (GRCm39) missense probably benign 0.09
R7725:St3gal4 UTSW 9 34,964,375 (GRCm39) missense possibly damaging 0.67
R8080:St3gal4 UTSW 9 35,017,617 (GRCm39) splice site probably null
R8356:St3gal4 UTSW 9 34,964,438 (GRCm39) missense probably damaging 1.00
R8936:St3gal4 UTSW 9 34,964,723 (GRCm39) missense probably damaging 1.00
R8984:St3gal4 UTSW 9 34,966,944 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGCACTCTTCAAAGGTTAGGTGC -3'
(R):5'- TCTCTCAGGTCTGGGACAAG -3'

Sequencing Primer
(F):5'- CTTCAAAGGTTAGGTGCAAGCTGC -3'
(R):5'- CTCAGGTCTGGGACAAGTCTTAC -3'
Posted On 2022-03-25