Incidental Mutation 'R9258:Arfgef3'
ID 702040
Institutional Source Beutler Lab
Gene Symbol Arfgef3
Ensembl Gene ENSMUSG00000019852
Gene Name ARFGEF family member 3
Synonyms B930094H20Rik, BIG3, D10Bwg1379e
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.146) question?
Stock # R9258 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 18463759-18619506 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 18465387 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 2152 (R2152H)
Ref Sequence ENSEMBL: ENSMUSP00000149210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019999] [ENSMUST00000215836]
AlphaFold Q3UGY8
Predicted Effect probably benign
Transcript: ENSMUST00000019999
SMART Domains Protein: ENSMUSP00000019999
Gene: ENSMUSG00000019852

DomainStartEndE-ValueType
Pfam:DCB 1 170 7.1e-15 PFAM
low complexity region 236 245 N/A INTRINSIC
low complexity region 276 295 N/A INTRINSIC
low complexity region 452 462 N/A INTRINSIC
Sec7 582 794 6e-54 SMART
Blast:Sec7 798 873 3e-20 BLAST
low complexity region 927 940 N/A INTRINSIC
Pfam:DUF1981 1237 1312 1.9e-14 PFAM
low complexity region 1641 1652 N/A INTRINSIC
low complexity region 1710 1723 N/A INTRINSIC
low complexity region 1838 1856 N/A INTRINSIC
low complexity region 2088 2099 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215836
AA Change: R2152H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased insulin granule biogenesis and insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 T A 8: 124,709,347 (GRCm39) Q69L probably benign Het
Abtb2 A C 2: 103,546,410 (GRCm39) Q930P probably null Het
Adam18 G A 8: 25,158,574 (GRCm39) T73I probably benign Het
Ankrd54 A T 15: 78,946,996 (GRCm39) M1K probably null Het
Anks1 T C 17: 28,277,400 (GRCm39) V1106A probably damaging Het
Aox1 A T 1: 58,351,515 (GRCm39) I701F probably damaging Het
Arnt2 C T 7: 84,010,798 (GRCm39) G37E probably damaging Het
Arpp21 G A 9: 111,953,956 (GRCm39) T581M probably benign Het
Arvcf A G 16: 18,216,957 (GRCm39) N428S probably damaging Het
C2cd3 A G 7: 100,098,026 (GRCm39) E1471G Het
Cadm1 A G 9: 47,710,730 (GRCm39) K211R probably benign Het
Cdh6 A G 15: 13,064,462 (GRCm39) S143P probably damaging Het
Cep152 G A 2: 125,421,356 (GRCm39) Q1125* probably null Het
Cfap54 A C 10: 92,770,960 (GRCm39) S2095A unknown Het
Col12a1 T C 9: 79,613,645 (GRCm39) T67A probably benign Het
Col6a3 T C 1: 90,700,703 (GRCm39) N3216S unknown Het
Cpeb2 T A 5: 43,391,455 (GRCm39) L217Q Het
Ctbp2 A T 7: 132,597,021 (GRCm39) N119K probably damaging Het
Des G T 1: 75,340,289 (GRCm39) V399L probably benign Het
Dnah2 G T 11: 69,368,079 (GRCm39) H1753Q probably damaging Het
Dnajc6 T C 4: 101,475,813 (GRCm39) V562A probably benign Het
Dusp13b T C 14: 21,791,155 (GRCm39) D99G probably benign Het
Ehd3 A G 17: 74,127,561 (GRCm39) I165V probably benign Het
Eme2 C T 17: 25,112,053 (GRCm39) V241M probably damaging Het
Eml5 A G 12: 98,810,376 (GRCm39) L860P possibly damaging Het
Eogt T A 6: 97,089,043 (GRCm39) K521M possibly damaging Het
Epb41l5 T C 1: 119,506,701 (GRCm39) T489A probably benign Het
Fmo5 G T 3: 97,558,802 (GRCm39) V421L probably benign Het
Gabpa C T 16: 84,653,403 (GRCm39) P268S probably benign Het
Gas2l3 G T 10: 89,262,315 (GRCm39) H136N probably benign Het
Gm5592 C T 7: 40,938,407 (GRCm39) A563V possibly damaging Het
Gpn3 A T 5: 122,519,508 (GRCm39) D205V probably benign Het
H13 T C 2: 152,522,999 (GRCm39) L104S probably damaging Het
H2-Q4 T A 17: 35,599,105 (GRCm39) V125E probably benign Het
Ifih1 A G 2: 62,442,242 (GRCm39) F374S probably damaging Het
Ildr2 A G 1: 166,131,158 (GRCm39) D338G probably damaging Het
Kmt2b A T 7: 30,281,893 (GRCm39) N1162K probably null Het
Lmntd1 T C 6: 145,359,256 (GRCm39) D298G probably damaging Het
Lrrc32 T A 7: 98,148,345 (GRCm39) V375E probably benign Het
Lrrc37a A C 11: 103,393,022 (GRCm39) I801R probably benign Het
Matcap1 A G 8: 106,008,775 (GRCm39) V414A probably damaging Het
Mgam A G 6: 40,657,121 (GRCm39) E935G probably benign Het
Mms22l A T 4: 24,588,238 (GRCm39) T917S probably damaging Het
Myo3a A T 2: 22,467,545 (GRCm39) E1204D possibly damaging Het
Nav3 T A 10: 109,550,243 (GRCm39) E1829V probably damaging Het
Nccrp1 C T 7: 28,245,632 (GRCm39) G150D probably damaging Het
Nlrp4b G T 7: 10,444,087 (GRCm39) W12L probably damaging Het
Nmb T C 7: 80,554,001 (GRCm39) T71A possibly damaging Het
Ogfod2 T A 5: 124,250,505 (GRCm39) H35Q probably benign Het
Ola1 A T 2: 72,929,732 (GRCm39) S290R probably damaging Het
Or1e30 T G 11: 73,678,281 (GRCm39) N172K probably benign Het
Or4k47 A T 2: 111,452,329 (GRCm39) I30N possibly damaging Het
Or51v15-ps1 T G 7: 103,278,543 (GRCm39) Y208S unknown Het
Or52e2 C A 7: 102,804,409 (GRCm39) E182* probably null Het
Or5p68 T G 7: 107,945,886 (GRCm39) T101P probably benign Het
Or9i14 A T 19: 13,792,099 (GRCm39) L285* probably null Het
Pcsk9 T C 4: 106,316,047 (GRCm39) D132G possibly damaging Het
Pkhd1 A T 1: 20,444,174 (GRCm39) V2296E probably damaging Het
Prl2c5 A T 13: 13,365,297 (GRCm39) I151L probably damaging Het
Prl3d3 A T 13: 27,344,931 (GRCm39) D101V possibly damaging Het
Prrt1 A G 17: 34,850,120 (GRCm39) Y178C probably damaging Het
Rasal1 A T 5: 120,793,155 (GRCm39) I87F possibly damaging Het
Rpgrip1l A T 8: 91,987,614 (GRCm39) Y814* probably null Het
Rpl3l T G 17: 24,951,447 (GRCm39) probably null Het
Rrbp1 C A 2: 143,853,161 (GRCm39) probably benign Het
Ryr3 A G 2: 112,483,364 (GRCm39) S4158P probably damaging Het
Scube2 G T 7: 109,398,515 (GRCm39) S951Y probably damaging Het
Sec14l1 T C 11: 117,041,002 (GRCm39) V396A probably benign Het
Sh3gl1 T A 17: 56,325,911 (GRCm39) K173* probably null Het
Shank3 A T 15: 89,388,521 (GRCm39) E371V probably damaging Het
Slc25a24 A G 3: 109,066,751 (GRCm39) T302A probably damaging Het
Slc25a41 A T 17: 57,348,580 (GRCm39) H4Q probably benign Het
Slc45a1 A T 4: 150,723,071 (GRCm39) V271D possibly damaging Het
Smad6 A T 9: 63,927,573 (GRCm39) L245Q probably damaging Het
Smad7 C A 18: 75,527,317 (GRCm39) Q388K probably damaging Het
Snx29 G T 16: 11,532,799 (GRCm39) D348Y possibly damaging Het
Son A T 16: 91,474,570 (GRCm39) H2418L unknown Het
Sppl3 G A 5: 115,233,922 (GRCm39) V331M probably damaging Het
St13 T G 15: 81,272,569 (GRCm39) T92P probably benign Het
St3gal4 A G 9: 34,963,643 (GRCm39) W222R probably damaging Het
Stk32a T A 18: 43,444,999 (GRCm39) N264K probably benign Het
Stoml3 T A 3: 53,405,397 (GRCm39) I26N possibly damaging Het
Taf7 T C 18: 37,776,021 (GRCm39) E182G probably damaging Het
Tas2r138 A G 6: 40,590,129 (GRCm39) V39A probably damaging Het
Tbc1d12 A G 19: 38,889,823 (GRCm39) S418G possibly damaging Het
Tbr1 T A 2: 61,642,723 (GRCm39) C663S probably benign Het
Tmc5 A T 7: 118,222,501 (GRCm39) Y67F probably benign Het
Tnfsf4 A C 1: 161,244,814 (GRCm39) I168L probably benign Het
Trav5-1 T G 14: 52,860,347 (GRCm39) S51A probably benign Het
Trmt10c A T 16: 55,854,646 (GRCm39) C330S possibly damaging Het
Trpm1 T C 7: 63,884,713 (GRCm39) M798T probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 115,958,998 (GRCm39) probably benign Het
Unc13d CATGCC CATGCCTCCGATGCC 11: 115,959,007 (GRCm39) probably benign Het
Vmn1r199 A G 13: 22,566,822 (GRCm39) T39A possibly damaging Het
Vmn1r74 T A 7: 11,580,999 (GRCm39) C100S possibly damaging Het
Vmn2r77 T A 7: 86,452,302 (GRCm39) I494K possibly damaging Het
Wdr17 G A 8: 55,112,654 (GRCm39) Q816* probably null Het
Other mutations in Arfgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Arfgef3 APN 10 18,536,352 (GRCm39) missense probably benign 0.03
IGL00835:Arfgef3 APN 10 18,537,106 (GRCm39) missense probably benign
IGL00961:Arfgef3 APN 10 18,486,985 (GRCm39) missense probably damaging 1.00
IGL01400:Arfgef3 APN 10 18,528,454 (GRCm39) missense probably damaging 1.00
IGL01501:Arfgef3 APN 10 18,476,308 (GRCm39) missense possibly damaging 0.93
IGL01595:Arfgef3 APN 10 18,470,660 (GRCm39) missense possibly damaging 0.93
IGL01695:Arfgef3 APN 10 18,479,167 (GRCm39) missense probably benign 0.00
IGL01774:Arfgef3 APN 10 18,619,363 (GRCm39) missense possibly damaging 0.94
IGL02348:Arfgef3 APN 10 18,467,095 (GRCm39) missense probably benign 0.04
IGL02371:Arfgef3 APN 10 18,522,287 (GRCm39) missense probably benign
IGL02400:Arfgef3 APN 10 18,522,005 (GRCm39) missense probably damaging 1.00
IGL02630:Arfgef3 APN 10 18,537,140 (GRCm39) splice site probably benign
IGL02815:Arfgef3 APN 10 18,528,299 (GRCm39) missense probably damaging 1.00
IGL03178:Arfgef3 APN 10 18,488,973 (GRCm39) missense probably damaging 1.00
IGL03182:Arfgef3 APN 10 18,476,292 (GRCm39) missense probably damaging 1.00
IGL03267:Arfgef3 APN 10 18,467,630 (GRCm39) missense probably damaging 1.00
IGL03294:Arfgef3 APN 10 18,540,660 (GRCm39) missense probably damaging 0.97
IGL03410:Arfgef3 APN 10 18,476,238 (GRCm39) missense probably damaging 1.00
Bow-wow UTSW 10 18,522,478 (GRCm39) nonsense probably null
R0098:Arfgef3 UTSW 10 18,465,390 (GRCm39) missense probably damaging 1.00
R0098:Arfgef3 UTSW 10 18,465,390 (GRCm39) missense probably damaging 1.00
R0141:Arfgef3 UTSW 10 18,473,155 (GRCm39) missense probably damaging 1.00
R0164:Arfgef3 UTSW 10 18,523,663 (GRCm39) missense possibly damaging 0.77
R0164:Arfgef3 UTSW 10 18,523,663 (GRCm39) missense possibly damaging 0.77
R0241:Arfgef3 UTSW 10 18,474,962 (GRCm39) missense probably damaging 1.00
R0334:Arfgef3 UTSW 10 18,468,029 (GRCm39) missense probably damaging 0.98
R0352:Arfgef3 UTSW 10 18,537,135 (GRCm39) missense probably benign 0.17
R0415:Arfgef3 UTSW 10 18,488,875 (GRCm39) splice site probably benign
R0417:Arfgef3 UTSW 10 18,479,259 (GRCm39) missense probably damaging 1.00
R0442:Arfgef3 UTSW 10 18,553,563 (GRCm39) splice site probably benign
R0507:Arfgef3 UTSW 10 18,467,369 (GRCm39) missense probably damaging 1.00
R0573:Arfgef3 UTSW 10 18,475,036 (GRCm39) missense probably damaging 1.00
R0582:Arfgef3 UTSW 10 18,487,038 (GRCm39) missense probably damaging 1.00
R0609:Arfgef3 UTSW 10 18,473,179 (GRCm39) missense probably benign 0.31
R0826:Arfgef3 UTSW 10 18,465,414 (GRCm39) missense probably damaging 0.98
R0919:Arfgef3 UTSW 10 18,465,483 (GRCm39) missense possibly damaging 0.89
R0980:Arfgef3 UTSW 10 18,467,866 (GRCm39) missense possibly damaging 0.82
R1027:Arfgef3 UTSW 10 18,467,123 (GRCm39) missense probably benign 0.02
R1140:Arfgef3 UTSW 10 18,473,096 (GRCm39) missense possibly damaging 0.77
R1491:Arfgef3 UTSW 10 18,522,302 (GRCm39) missense probably damaging 1.00
R1493:Arfgef3 UTSW 10 18,506,627 (GRCm39) missense probably damaging 0.96
R1529:Arfgef3 UTSW 10 18,488,970 (GRCm39) nonsense probably null
R1564:Arfgef3 UTSW 10 18,467,452 (GRCm39) missense probably damaging 1.00
R1654:Arfgef3 UTSW 10 18,500,896 (GRCm39) missense probably null 0.15
R1868:Arfgef3 UTSW 10 18,537,135 (GRCm39) missense probably benign 0.17
R1876:Arfgef3 UTSW 10 18,473,104 (GRCm39) missense probably damaging 1.00
R1908:Arfgef3 UTSW 10 18,528,511 (GRCm39) missense possibly damaging 0.80
R2211:Arfgef3 UTSW 10 18,467,993 (GRCm39) missense possibly damaging 0.54
R2316:Arfgef3 UTSW 10 18,492,701 (GRCm39) missense probably benign 0.19
R2393:Arfgef3 UTSW 10 18,473,535 (GRCm39) missense possibly damaging 0.88
R2407:Arfgef3 UTSW 10 18,553,614 (GRCm39) missense possibly damaging 0.63
R3076:Arfgef3 UTSW 10 18,479,278 (GRCm39) missense probably damaging 0.99
R3077:Arfgef3 UTSW 10 18,479,278 (GRCm39) missense probably damaging 0.99
R3963:Arfgef3 UTSW 10 18,468,025 (GRCm39) missense probably damaging 1.00
R4201:Arfgef3 UTSW 10 18,495,530 (GRCm39) missense probably benign 0.01
R4241:Arfgef3 UTSW 10 18,500,912 (GRCm39) missense probably damaging 1.00
R4244:Arfgef3 UTSW 10 18,506,168 (GRCm39) missense probably damaging 1.00
R4395:Arfgef3 UTSW 10 18,473,457 (GRCm39) missense probably damaging 1.00
R4455:Arfgef3 UTSW 10 18,483,423 (GRCm39) missense probably benign 0.18
R4480:Arfgef3 UTSW 10 18,476,348 (GRCm39) missense probably damaging 1.00
R4499:Arfgef3 UTSW 10 18,484,091 (GRCm39) missense possibly damaging 0.95
R4589:Arfgef3 UTSW 10 18,521,947 (GRCm39) missense probably damaging 1.00
R4635:Arfgef3 UTSW 10 18,510,603 (GRCm39) missense probably damaging 1.00
R4776:Arfgef3 UTSW 10 18,529,995 (GRCm39) missense probably benign
R4801:Arfgef3 UTSW 10 18,467,654 (GRCm39) missense probably benign 0.00
R4802:Arfgef3 UTSW 10 18,467,654 (GRCm39) missense probably benign 0.00
R4807:Arfgef3 UTSW 10 18,522,385 (GRCm39) missense probably benign
R4828:Arfgef3 UTSW 10 18,528,441 (GRCm39) missense probably damaging 0.99
R4861:Arfgef3 UTSW 10 18,483,479 (GRCm39) missense probably benign 0.01
R4861:Arfgef3 UTSW 10 18,483,479 (GRCm39) missense probably benign 0.01
R4917:Arfgef3 UTSW 10 18,492,638 (GRCm39) missense probably damaging 0.99
R4918:Arfgef3 UTSW 10 18,492,638 (GRCm39) missense probably damaging 0.99
R4922:Arfgef3 UTSW 10 18,467,934 (GRCm39) missense probably damaging 0.97
R4929:Arfgef3 UTSW 10 18,506,599 (GRCm39) missense probably benign 0.00
R4937:Arfgef3 UTSW 10 18,465,454 (GRCm39) missense probably damaging 0.98
R5290:Arfgef3 UTSW 10 18,476,208 (GRCm39) missense probably damaging 1.00
R5410:Arfgef3 UTSW 10 18,486,985 (GRCm39) missense probably damaging 0.99
R5807:Arfgef3 UTSW 10 18,523,546 (GRCm39) splice site probably null
R5832:Arfgef3 UTSW 10 18,506,168 (GRCm39) missense probably damaging 1.00
R5887:Arfgef3 UTSW 10 18,483,413 (GRCm39) nonsense probably null
R6272:Arfgef3 UTSW 10 18,522,711 (GRCm39) missense probably benign 0.00
R6302:Arfgef3 UTSW 10 18,528,589 (GRCm39) missense probably damaging 0.97
R6397:Arfgef3 UTSW 10 18,483,413 (GRCm39) nonsense probably null
R6495:Arfgef3 UTSW 10 18,486,950 (GRCm39) critical splice donor site probably null
R6707:Arfgef3 UTSW 10 18,496,903 (GRCm39) missense probably benign 0.11
R6814:Arfgef3 UTSW 10 18,470,767 (GRCm39) missense probably damaging 1.00
R6830:Arfgef3 UTSW 10 18,540,637 (GRCm39) critical splice donor site probably null
R6870:Arfgef3 UTSW 10 18,522,478 (GRCm39) nonsense probably null
R6941:Arfgef3 UTSW 10 18,501,203 (GRCm39) missense possibly damaging 0.66
R7094:Arfgef3 UTSW 10 18,522,187 (GRCm39) missense probably damaging 1.00
R7179:Arfgef3 UTSW 10 18,475,015 (GRCm39) missense probably damaging 1.00
R7204:Arfgef3 UTSW 10 18,522,210 (GRCm39) missense probably damaging 1.00
R7247:Arfgef3 UTSW 10 18,501,139 (GRCm39) missense probably benign 0.00
R7249:Arfgef3 UTSW 10 18,506,583 (GRCm39) missense possibly damaging 0.62
R7318:Arfgef3 UTSW 10 18,506,211 (GRCm39) missense possibly damaging 0.89
R7391:Arfgef3 UTSW 10 18,522,007 (GRCm39) missense probably benign 0.05
R7527:Arfgef3 UTSW 10 18,522,377 (GRCm39) missense probably benign
R7618:Arfgef3 UTSW 10 18,522,029 (GRCm39) missense probably damaging 1.00
R7779:Arfgef3 UTSW 10 18,470,771 (GRCm39) missense probably damaging 0.99
R7851:Arfgef3 UTSW 10 18,468,034 (GRCm39) missense probably damaging 1.00
R8112:Arfgef3 UTSW 10 18,528,379 (GRCm39) missense possibly damaging 0.96
R8133:Arfgef3 UTSW 10 18,486,951 (GRCm39) critical splice donor site probably null
R8242:Arfgef3 UTSW 10 18,505,824 (GRCm39) missense probably benign 0.25
R8369:Arfgef3 UTSW 10 18,465,477 (GRCm39) missense probably benign 0.34
R8396:Arfgef3 UTSW 10 18,528,280 (GRCm39) critical splice donor site probably null
R8553:Arfgef3 UTSW 10 18,479,278 (GRCm39) missense probably damaging 0.99
R8798:Arfgef3 UTSW 10 18,522,799 (GRCm39) missense probably damaging 1.00
R8821:Arfgef3 UTSW 10 18,528,491 (GRCm39) missense possibly damaging 0.95
R8831:Arfgef3 UTSW 10 18,528,491 (GRCm39) missense possibly damaging 0.95
R8918:Arfgef3 UTSW 10 18,511,453 (GRCm39) missense probably benign 0.01
R8929:Arfgef3 UTSW 10 18,479,203 (GRCm39) missense probably damaging 1.00
R9001:Arfgef3 UTSW 10 18,522,476 (GRCm39) missense probably benign 0.32
R9077:Arfgef3 UTSW 10 18,500,899 (GRCm39) missense possibly damaging 0.81
R9267:Arfgef3 UTSW 10 18,475,028 (GRCm39) missense probably damaging 1.00
R9358:Arfgef3 UTSW 10 18,492,628 (GRCm39) missense probably damaging 1.00
R9388:Arfgef3 UTSW 10 18,505,877 (GRCm39) missense probably benign 0.35
R9389:Arfgef3 UTSW 10 18,479,271 (GRCm39) missense probably damaging 1.00
R9563:Arfgef3 UTSW 10 18,522,275 (GRCm39) missense probably damaging 1.00
R9713:Arfgef3 UTSW 10 18,528,556 (GRCm39) missense probably damaging 1.00
X0026:Arfgef3 UTSW 10 18,528,374 (GRCm39) missense probably damaging 1.00
Z1176:Arfgef3 UTSW 10 18,510,600 (GRCm39) missense probably benign 0.26
Z1176:Arfgef3 UTSW 10 18,484,106 (GRCm39) missense probably damaging 0.97
Z1176:Arfgef3 UTSW 10 18,467,185 (GRCm39) missense probably damaging 1.00
Z1177:Arfgef3 UTSW 10 18,503,376 (GRCm39) missense probably damaging 1.00
Z1177:Arfgef3 UTSW 10 18,483,524 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCCAGACTAACCCAAGGTTG -3'
(R):5'- TGCAAAGCCATGAGATAGCC -3'

Sequencing Primer
(F):5'- CAGACTAACCCAAGGTTGACTAGG -3'
(R):5'- GCCATGAGATAGCCAGTAATTCTC -3'
Posted On 2022-03-25