Mutagenetix > Incidental Mutation

Incidental Mutation 'R9258:Cfap54'

702042

Institutional Source

Beutler Lab

Gene Symbol

Cfap54

Ensembl Gene

ENSMUSG00000020014

Gene Name

cilia and flagella associated protein 54

Synonyms

LOC380653, Gm872, 4930485B16Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R9258 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

92775619-93081618 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 92935098 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 2095 (S2095A)

Ref Sequence

ENSEMBL: ENSMUSP00000148636 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164979] [ENSMUST00000168110] [ENSMUST00000212902]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000164979
AA Change: S169A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000129650
Gene: ENSMUSG00000020014
AA Change: S169A

Domain	Start	End	E-Value	Type
low complexity region	113	123	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000168110
AA Change: S2030A

SMART Domains

Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: S2030A

Domain	Start	End	E-Value	Type
low complexity region	3	37	N/A	INTRINSIC
low complexity region	39	48	N/A	INTRINSIC
Pfam:DUF4486	104	642	1.1e-269	PFAM
low complexity region	842	851	N/A	INTRINSIC
low complexity region	902	915	N/A	INTRINSIC
Blast:FN3	916	1002	4e-48	BLAST
low complexity region	1409	1426	N/A	INTRINSIC
low complexity region	1974	1984	N/A	INTRINSIC
low complexity region	2354	2370	N/A	INTRINSIC
low complexity region	2500	2513	N/A	INTRINSIC
low complexity region	2605	2616	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000212902
AA Change: S2095A

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931428F04Rik	A	G	8: 105,282,143	V414A	probably damaging	Het
Abcb10	T	A	8: 123,982,608	Q69L	probably benign	Het
Abtb2	A	C	2: 103,716,065	Q930P	probably null	Het
Adam18	G	A	8: 24,668,558	T73I	probably benign	Het
Ankrd54	A	T	15: 79,062,796	M1K	probably null	Het
Anks1	T	C	17: 28,058,426	V1106A	probably damaging	Het
Aox2	A	T	1: 58,312,356	I701F	probably damaging	Het
Arfgef3	C	T	10: 18,589,639	R2152H	probably damaging	Het
Arnt2	C	T	7: 84,361,590	G37E	probably damaging	Het
Arpp21	G	A	9: 112,124,888	T581M	probably benign	Het
Arvcf	A	G	16: 18,398,207	N428S	probably damaging	Het
C2cd3	A	G	7: 100,448,819	E1471G		Het
Cadm1	A	G	9: 47,799,432	K211R	probably benign	Het
Cdh6	A	G	15: 13,064,376	S143P	probably damaging	Het
Cep152	G	A	2: 125,579,436	Q1125*	probably null	Het
Col12a1	T	C	9: 79,706,363	T67A	probably benign	Het
Col6a3	T	C	1: 90,772,981	N3216S	unknown	Het
Cpeb2	T	A	5: 43,234,112	L217Q		Het
Ctbp2	A	T	7: 132,995,292	N119K	probably damaging	Het
Des	G	T	1: 75,363,645	V399L	probably benign	Het
Dnah2	G	T	11: 69,477,253	H1753Q	probably damaging	Het
Dnajc6	T	C	4: 101,618,616	V562A	probably benign	Het
Dusp13	T	C	14: 21,741,087	D99G	probably benign	Het
Ehd3	A	G	17: 73,820,566	I165V	probably benign	Het
Eme2	C	T	17: 24,893,079	V241M	probably damaging	Het
Eml5	A	G	12: 98,844,117	L860P	possibly damaging	Het
Eogt	T	A	6: 97,112,082	K521M	possibly damaging	Het
Epb41l5	T	C	1: 119,578,971	T489A	probably benign	Het
Fmo5	G	T	3: 97,651,486	V421L	probably benign	Het
Gabpa	C	T	16: 84,856,515	P268S	probably benign	Het
Gas2l3	G	T	10: 89,426,453	H136N	probably benign	Het
Gm5592	C	T	7: 41,288,983	A563V	possibly damaging	Het
Gpn3	A	T	5: 122,381,445	D205V	probably benign	Het
H13	T	C	2: 152,681,079	L104S	probably damaging	Het
H2-Q4	T	A	17: 35,380,129	V125E	probably benign	Het
Ifih1	A	G	2: 62,611,898	F374S	probably damaging	Het
Ildr2	A	G	1: 166,303,589	D338G	probably damaging	Het
Kmt2b	A	T	7: 30,582,468	N1162K	probably null	Het
Lmntd1	T	C	6: 145,413,530	D298G	probably damaging	Het
Lrrc32	T	A	7: 98,499,138	V375E	probably benign	Het
Lrrc37a	A	C	11: 103,502,196	I801R	probably benign	Het
Mgam	A	G	6: 40,680,187	E935G	probably benign	Het
Mms22l	A	T	4: 24,588,238	T917S	probably damaging	Het
Myo3a	A	T	2: 22,577,533	E1204D	possibly damaging	Het
Nav3	T	A	10: 109,714,382	E1829V	probably damaging	Het
Nccrp1	C	T	7: 28,546,207	G150D	probably damaging	Het
Nlrp4b	G	T	7: 10,710,160	W12L	probably damaging	Het
Nmb	T	C	7: 80,904,253	T71A	possibly damaging	Het
Ogfod2	T	A	5: 124,112,442	H35Q	probably benign	Het
Ola1	A	T	2: 73,099,388	S290R	probably damaging	Het
Olfr1297	A	T	2: 111,621,984	I30N	possibly damaging	Het
Olfr1499	A	T	19: 13,814,735	L285*	probably null	Het
Olfr390	T	G	11: 73,787,455	N172K	probably benign	Het
Olfr493	T	G	7: 108,346,679	T101P	probably benign	Het
Olfr589	C	A	7: 103,155,202	E182*	probably null	Het
Olfr621-ps1	T	G	7: 103,629,336	Y208S	unknown	Het
Pcsk9	T	C	4: 106,458,850	D132G	possibly damaging	Het
Pkhd1	A	T	1: 20,373,950	V2296E	probably damaging	Het
Prl2c5	A	T	13: 13,190,712	I151L	probably damaging	Het
Prl3d3	A	T	13: 27,160,948	D101V	possibly damaging	Het
Prrt1	A	G	17: 34,631,146	Y178C	probably damaging	Het
Rasal1	A	T	5: 120,655,090	I87F	possibly damaging	Het
Rpgrip1l	A	T	8: 91,260,986	Y814*	probably null	Het
Rpl3l	T	G	17: 24,732,473		probably null	Het
Rrbp1	C	A	2: 144,011,241		probably benign	Het
Ryr3	A	G	2: 112,653,019	S4158P	probably damaging	Het
Scube2	G	T	7: 109,799,308	S951Y	probably damaging	Het
Sec14l1	T	C	11: 117,150,176	V396A	probably benign	Het
Sh3gl1	T	A	17: 56,018,911	K173*	probably null	Het
Shank3	A	T	15: 89,504,318	E371V	probably damaging	Het
Slc25a24	A	G	3: 109,159,435	T302A	probably damaging	Het
Slc25a41	A	T	17: 57,041,580	H4Q	probably benign	Het
Slc45a1	A	T	4: 150,638,614	V271D	possibly damaging	Het
Smad6	A	T	9: 64,020,291	L245Q	probably damaging	Het
Smad7	C	A	18: 75,394,246	Q388K	probably damaging	Het
Snx29	G	T	16: 11,714,935	D348Y	possibly damaging	Het
Son	A	T	16: 91,677,682	H2418L	unknown	Het
Sppl3	G	A	5: 115,095,863	V331M	probably damaging	Het
St13	T	G	15: 81,388,368	T92P	probably benign	Het
St3gal4	A	G	9: 35,052,347	W222R	probably damaging	Het
Stk32a	T	A	18: 43,311,934	N264K	probably benign	Het
Stoml3	T	A	3: 53,497,976	I26N	possibly damaging	Het
Taf7	T	C	18: 37,642,968	E182G	probably damaging	Het
Tas2r138	A	G	6: 40,613,195	V39A	probably damaging	Het
Tbc1d12	A	G	19: 38,901,379	S418G	possibly damaging	Het
Tbr1	T	A	2: 61,812,379	C663S	probably benign	Het
Tmc5	A	T	7: 118,623,278	Y67F	probably benign	Het
Tnfsf4	A	C	1: 161,417,243	I168L	probably benign	Het
Trav5-1	T	G	14: 52,622,890	S51A	probably benign	Het
Trmt10c	A	T	16: 56,034,283	C330S	possibly damaging	Het
Trpm1	T	C	7: 64,234,965	M798T	probably benign	Het
Unc13d	AATGCCTCCCATGCC	AATGCCTCCCATGCCTCCCATGCC	11: 116,068,172		probably benign	Het
Unc13d	CATGCC	CATGCCTCCGATGCC	11: 116,068,181		probably benign	Het
Vmn1r199	A	G	13: 22,382,652	T39A	possibly damaging	Het
Vmn1r74	T	A	7: 11,847,072	C100S	possibly damaging	Het
Vmn2r77	T	A	7: 86,803,094	I494K	possibly damaging	Het
Wdr17	G	A	8: 54,659,619	Q816*	probably null	Het

Other mutations in Cfap54

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cfap54	APN	10	93081523	missense	unknown
IGL02034:Cfap54	APN	10	93061485	missense	probably damaging	0.99
IGL02082:Cfap54	APN	10	93081458	missense	unknown
IGL02434:Cfap54	APN	10	93066754	missense	probably benign	0.20
R0011:Cfap54	UTSW	10	93065225	missense	probably damaging	0.97
R0011:Cfap54	UTSW	10	93065225	missense	probably damaging	0.97
R0032:Cfap54	UTSW	10	92932697	missense	probably benign	0.04
R0032:Cfap54	UTSW	10	92932697	missense	probably benign	0.04
R0040:Cfap54	UTSW	10	92977039	missense	probably benign	0.33
R0044:Cfap54	UTSW	10	93035433	missense	probably null	0.46
R0086:Cfap54	UTSW	10	93028594	missense	possibly damaging	0.86
R0104:Cfap54	UTSW	10	93028652	missense	probably damaging	1.00
R0194:Cfap54	UTSW	10	93034662	unclassified	probably benign
R0234:Cfap54	UTSW	10	92899160	nonsense	probably null
R0308:Cfap54	UTSW	10	92885364	missense	unknown
R0332:Cfap54	UTSW	10	93035457	missense	probably damaging	1.00
R0409:Cfap54	UTSW	10	92776213	missense	probably benign	0.00
R0433:Cfap54	UTSW	10	92979080	splice site	probably benign
R0436:Cfap54	UTSW	10	93038975	missense	possibly damaging	0.95
R0463:Cfap54	UTSW	10	92874943	critical splice donor site	probably null
R0523:Cfap54	UTSW	10	92908883	utr 3 prime	probably benign
R0551:Cfap54	UTSW	10	93025122	missense	probably benign	0.35
R0595:Cfap54	UTSW	10	92884736	missense	unknown
R0617:Cfap54	UTSW	10	92829650	splice site	probably benign
R0632:Cfap54	UTSW	10	92885096	missense	unknown
R0730:Cfap54	UTSW	10	93034737	missense	probably benign	0.05
R0786:Cfap54	UTSW	10	92967535	missense	possibly damaging	0.72
R0883:Cfap54	UTSW	10	92870669	missense	unknown
R1004:Cfap54	UTSW	10	93066696	splice site	probably benign
R1033:Cfap54	UTSW	10	92839449	missense	probably benign	0.07
R1168:Cfap54	UTSW	10	92937920	missense	probably damaging	0.99
R1186:Cfap54	UTSW	10	92875994	missense	unknown
R1429:Cfap54	UTSW	10	92821038	missense	probably benign	0.01
R1443:Cfap54	UTSW	10	92932721	missense	probably damaging	1.00
R1467:Cfap54	UTSW	10	92969763	missense	probably benign	0.01
R1557:Cfap54	UTSW	10	92984227	missense	possibly damaging	0.68
R1687:Cfap54	UTSW	10	92932640	missense	probably damaging	1.00
R1690:Cfap54	UTSW	10	93035442	missense	possibly damaging	0.95
R1711:Cfap54	UTSW	10	93011020	missense	probably damaging	1.00
R1756:Cfap54	UTSW	10	93048061	missense	probably damaging	1.00
R1769:Cfap54	UTSW	10	92904263	critical splice donor site	probably null
R1835:Cfap54	UTSW	10	92962375	missense	probably benign	0.35
R1889:Cfap54	UTSW	10	93034710	missense	possibly damaging	0.94
R1915:Cfap54	UTSW	10	92884702	missense	unknown
R1958:Cfap54	UTSW	10	92997342	missense	probably benign	0.18
R2005:Cfap54	UTSW	10	92884768	missense	unknown
R2018:Cfap54	UTSW	10	93016604	missense	probably benign	0.00
R2045:Cfap54	UTSW	10	93038809	splice site	probably null
R2059:Cfap54	UTSW	10	92942979	unclassified	probably benign
R2100:Cfap54	UTSW	10	93001937	missense	possibly damaging	0.84
R2110:Cfap54	UTSW	10	92886367	missense	unknown
R2392:Cfap54	UTSW	10	93025011	critical splice donor site	probably null
R2508:Cfap54	UTSW	10	92997374	missense	possibly damaging	0.72
R2852:Cfap54	UTSW	10	92940155	missense	probably damaging	1.00
R2857:Cfap54	UTSW	10	93045282	missense	probably damaging	0.99
R2871:Cfap54	UTSW	10	92921419	missense	possibly damaging	0.86
R2871:Cfap54	UTSW	10	92921419	missense	possibly damaging	0.86
R3107:Cfap54	UTSW	10	92994683	missense	probably benign	0.04
R3108:Cfap54	UTSW	10	92994683	missense	probably benign	0.04
R3157:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3158:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3159:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3161:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3162:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3162:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3508:Cfap54	UTSW	10	92885424	missense	unknown
R3730:Cfap54	UTSW	10	93011473	nonsense	probably null
R3770:Cfap54	UTSW	10	92878536	missense	unknown
R3776:Cfap54	UTSW	10	93045100	missense	probably damaging	1.00
R3778:Cfap54	UTSW	10	92904344	utr 3 prime	probably benign
R3795:Cfap54	UTSW	10	92942873	unclassified	probably benign
R3834:Cfap54	UTSW	10	92801123	splice site	probably benign
R3891:Cfap54	UTSW	10	93038846	missense	possibly damaging	0.87
R3932:Cfap54	UTSW	10	92829757	missense	probably benign	0.03
R3973:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3974:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3976:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3978:Cfap54	UTSW	10	92962412	missense	probably benign	0.01
R4190:Cfap54	UTSW	10	92885023	missense	unknown
R4389:Cfap54	UTSW	10	92967500	missense	probably benign	0.37
R4542:Cfap54	UTSW	10	93025129	missense	probably benign	0.12
R4564:Cfap54	UTSW	10	92839540	unclassified	probably benign
R4576:Cfap54	UTSW	10	93043228	critical splice donor site	probably null
R4620:Cfap54	UTSW	10	92969757	missense	probably benign	0.01
R4714:Cfap54	UTSW	10	92815918	missense	probably benign	0.01
R4762:Cfap54	UTSW	10	93061453	splice site	probably null
R4776:Cfap54	UTSW	10	92972694	missense	possibly damaging	0.96
R4819:Cfap54	UTSW	10	92836477	nonsense	probably null
R4827:Cfap54	UTSW	10	92902075	utr 3 prime	probably benign
R4832:Cfap54	UTSW	10	92967528	missense	probably benign	0.01
R4965:Cfap54	UTSW	10	93066799	missense	probably benign	0.23
R5001:Cfap54	UTSW	10	92964534	missense	probably benign	0.01
R5060:Cfap54	UTSW	10	93039151	missense	probably damaging	1.00
R5067:Cfap54	UTSW	10	93066766	missense	probably benign	0.17
R5069:Cfap54	UTSW	10	92937774	missense	probably benign
R5094:Cfap54	UTSW	10	92898999	utr 3 prime	probably benign
R5109:Cfap54	UTSW	10	92937891	missense	probably benign	0.03
R5127:Cfap54	UTSW	10	92886387	splice site	probably null
R5143:Cfap54	UTSW	10	93029158	missense	possibly damaging	0.73
R5147:Cfap54	UTSW	10	92937838	missense	probably benign	0.00
R5158:Cfap54	UTSW	10	93065197	missense	probably damaging	1.00
R5256:Cfap54	UTSW	10	92935091	nonsense	probably null
R5256:Cfap54	UTSW	10	93045023	splice site	probably null
R5266:Cfap54	UTSW	10	92815902	missense	probably benign	0.16
R5304:Cfap54	UTSW	10	92821106	missense	probably damaging	0.97
R5369:Cfap54	UTSW	10	93061257	intron	probably benign
R5406:Cfap54	UTSW	10	93001858	missense	probably benign	0.33
R5471:Cfap54	UTSW	10	93028660	missense	probably damaging	1.00
R5485:Cfap54	UTSW	10	93029117	missense	probably damaging	1.00
R5540:Cfap54	UTSW	10	92972608	missense	possibly damaging	0.85
R5586:Cfap54	UTSW	10	92972611	nonsense	probably null
R5614:Cfap54	UTSW	10	93045049	missense	probably damaging	1.00
R5634:Cfap54	UTSW	10	92904263	critical splice donor site	probably benign
R5680:Cfap54	UTSW	10	92979017	nonsense	probably null
R5797:Cfap54	UTSW	10	92967576	missense	probably benign	0.11
R5859:Cfap54	UTSW	10	93016524	nonsense	probably null
R5878:Cfap54	UTSW	10	92964561	missense	probably benign	0.01
R5910:Cfap54	UTSW	10	93065181	missense	probably damaging	0.99
R5936:Cfap54	UTSW	10	92962412	missense	probably benign	0.01
R5994:Cfap54	UTSW	10	93039081	missense	probably damaging	0.99
R6080:Cfap54	UTSW	10	93045335	missense	possibly damaging	0.64
R6268:Cfap54	UTSW	10	93038909	missense	probably damaging	1.00
R6296:Cfap54	UTSW	10	93066846	missense	probably damaging	1.00
R6409:Cfap54	UTSW	10	92967492	missense	probably benign	0.04
R6545:Cfap54	UTSW	10	92836457	missense	probably benign	0.31
R6570:Cfap54	UTSW	10	92815958	missense	unknown
R6597:Cfap54	UTSW	10	92999040	missense	possibly damaging	0.85
R6702:Cfap54	UTSW	10	92868734	missense	unknown
R6703:Cfap54	UTSW	10	92868734	missense	unknown
R6720:Cfap54	UTSW	10	92821119	missense	probably benign	0.07
R6841:Cfap54	UTSW	10	92875015	missense	unknown
R6910:Cfap54	UTSW	10	92836512	missense	probably benign	0.29
R6953:Cfap54	UTSW	10	92994678	missense	probably benign	0.19
R7009:Cfap54	UTSW	10	92875019	missense	unknown
R7129:Cfap54	UTSW	10	93016571	missense	probably benign	0.06
R7131:Cfap54	UTSW	10	92821104	missense	probably benign	0.03
R7171:Cfap54	UTSW	10	92776210	missense	probably damaging	0.99
R7189:Cfap54	UTSW	10	92937728	missense	unknown
R7225:Cfap54	UTSW	10	92904374	missense	unknown
R7270:Cfap54	UTSW	10	92839458	missense	probably benign	0.03
R7323:Cfap54	UTSW	10	92801138	missense	probably benign	0.00
R7380:Cfap54	UTSW	10	93047978	missense	probably damaging	1.00
R7395:Cfap54	UTSW	10	92884703	missense	unknown
R7411:Cfap54	UTSW	10	92868755	missense	unknown
R7503:Cfap54	UTSW	10	92887436	splice site	probably null
R7622:Cfap54	UTSW	10	92956944	missense	unknown
R7679:Cfap54	UTSW	10	92967512	missense	probably benign	0.01
R7776:Cfap54	UTSW	10	92868741	missense	unknown
R7844:Cfap54	UTSW	10	92902058	missense	unknown
R7980:Cfap54	UTSW	10	92982060	missense	possibly damaging	0.95
R7988:Cfap54	UTSW	10	92902079	missense	unknown
R8101:Cfap54	UTSW	10	92884796	missense	unknown
R8119:Cfap54	UTSW	10	92868810	missense	unknown
R8134:Cfap54	UTSW	10	92878516	missense	unknown
R8168:Cfap54	UTSW	10	92908877	missense	unknown
R8179:Cfap54	UTSW	10	92997316	missense	possibly damaging	0.68
R8392:Cfap54	UTSW	10	92962417	missense	unknown
R8436:Cfap54	UTSW	10	92964536	missense	unknown
R8505:Cfap54	UTSW	10	92978993	missense	probably benign	0.03
R8671:Cfap54	UTSW	10	92955072	missense	unknown
R8716:Cfap54	UTSW	10	92964632	missense	probably benign	0.00
R8816:Cfap54	UTSW	10	92878592	missense	unknown
R8822:Cfap54	UTSW	10	93039141	missense	probably benign	0.09
R8827:Cfap54	UTSW	10	92938248	missense	unknown
R8920:Cfap54	UTSW	10	92940337	critical splice acceptor site	probably null
R8924:Cfap54	UTSW	10	93001823	missense	probably damaging	0.99
R8954:Cfap54	UTSW	10	93043393	missense	probably damaging	1.00
R8963:Cfap54	UTSW	10	93028700	nonsense	probably null
R9010:Cfap54	UTSW	10	92899059	missense	unknown
R9017:Cfap54	UTSW	10	92816021	missense	probably benign	0.07
R9093:Cfap54	UTSW	10	92815908	missense	probably benign	0.03
R9095:Cfap54	UTSW	10	93011020	missense	probably damaging	1.00
R9142:Cfap54	UTSW	10	92984235	missense	possibly damaging	0.87
R9178:Cfap54	UTSW	10	92994717	missense	probably benign	0.10
R9196:Cfap54	UTSW	10	93037891	missense	probably benign	0.22
R9203:Cfap54	UTSW	10	93045128	missense	probably benign	0.30
R9275:Cfap54	UTSW	10	93039186	missense	possibly damaging	0.86
R9287:Cfap54	UTSW	10	92969703	missense	possibly damaging	0.50
R9289:Cfap54	UTSW	10	92821074	missense	possibly damaging	0.83
R9310:Cfap54	UTSW	10	92962315	missense	unknown
R9397:Cfap54	UTSW	10	92997285	missense	probably damaging	0.96
R9462:Cfap54	UTSW	10	92902058	missense	unknown
R9697:Cfap54	UTSW	10	92956989	missense	unknown
R9746:Cfap54	UTSW	10	92801219	missense	probably benign	0.03
R9755:Cfap54	UTSW	10	92921368	missense	unknown
X0022:Cfap54	UTSW	10	92878603	missense	unknown
X0022:Cfap54	UTSW	10	92932614	missense	probably damaging	1.00
X0027:Cfap54	UTSW	10	92878538	missense	unknown
X0027:Cfap54	UTSW	10	93001888	missense	possibly damaging	0.86
Z1177:Cfap54	UTSW	10	92979026	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGTCCAGCAGAGCTCATG -3'
(R):5'- ATCAAAGCATTGCCAGTGGTAGG -3'

Sequencing Primer
(F):5'- GCTCATGCTAACTCCTCCTC -3'
(R):5'- AAAGCATTGCCAGTGGTAGGATTTG -3'

Posted On

2022-03-25