Incidental Mutation 'R9258:Dnah2'
ID 702044
Institutional Source Beutler Lab
Gene Symbol Dnah2
Ensembl Gene ENSMUSG00000005237
Gene Name dynein, axonemal, heavy chain 2
Synonyms 2900022L05Rik, D330014H01Rik, Dnahc2, Dnhd3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9258 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 69311635-69439934 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 69368079 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 1753 (H1753Q)
Ref Sequence ENSEMBL: ENSMUSP00000104299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035539] [ENSMUST00000108659]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000035539
AA Change: H1747Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047329
Gene: ENSMUSG00000005237
AA Change: H1747Q

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 273 429 6.6e-37 PFAM
Pfam:DHC_N1 432 761 1.3e-54 PFAM
Pfam:DHC_N2 1253 1668 3.4e-144 PFAM
AAA 1826 1962 2.95e-1 SMART
Pfam:AAA_5 2108 2251 1.3e-5 PFAM
AAA 2437 2584 3.63e-5 SMART
Pfam:AAA_8 2752 3022 1.1e-75 PFAM
Pfam:MT 3034 3370 8.7e-55 PFAM
Pfam:AAA_9 3386 3616 7.4e-68 PFAM
Pfam:Dynein_heavy 3748 4453 1.2e-220 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108659
AA Change: H1753Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104299
Gene: ENSMUSG00000005237
AA Change: H1753Q

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 274 429 1.1e-47 PFAM
Pfam:DHC_N1 438 760 1.5e-75 PFAM
Pfam:DHC_N2 1255 1666 4.4e-144 PFAM
low complexity region 1711 1720 N/A INTRINSIC
AAA 1832 1968 2.95e-1 SMART
Blast:AAA 2111 2251 2e-86 BLAST
AAA 2443 2590 3.63e-5 SMART
Pfam:AAA_8 2758 3028 5.5e-77 PFAM
Pfam:MT 3040 3376 7.6e-55 PFAM
Pfam:AAA_9 3396 3621 7.5e-94 PFAM
Pfam:Dynein_heavy 3759 4458 4.9e-264 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH2 is an axonemal inner arm dynein heavy chain (Chapelin et al., 1997 [PubMed 9256245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 T A 8: 124,709,347 (GRCm39) Q69L probably benign Het
Abtb2 A C 2: 103,546,410 (GRCm39) Q930P probably null Het
Adam18 G A 8: 25,158,574 (GRCm39) T73I probably benign Het
Ankrd54 A T 15: 78,946,996 (GRCm39) M1K probably null Het
Anks1 T C 17: 28,277,400 (GRCm39) V1106A probably damaging Het
Aox1 A T 1: 58,351,515 (GRCm39) I701F probably damaging Het
Arfgef3 C T 10: 18,465,387 (GRCm39) R2152H probably damaging Het
Arnt2 C T 7: 84,010,798 (GRCm39) G37E probably damaging Het
Arpp21 G A 9: 111,953,956 (GRCm39) T581M probably benign Het
Arvcf A G 16: 18,216,957 (GRCm39) N428S probably damaging Het
C2cd3 A G 7: 100,098,026 (GRCm39) E1471G Het
Cadm1 A G 9: 47,710,730 (GRCm39) K211R probably benign Het
Cdh6 A G 15: 13,064,462 (GRCm39) S143P probably damaging Het
Cep152 G A 2: 125,421,356 (GRCm39) Q1125* probably null Het
Cfap54 A C 10: 92,770,960 (GRCm39) S2095A unknown Het
Col12a1 T C 9: 79,613,645 (GRCm39) T67A probably benign Het
Col6a3 T C 1: 90,700,703 (GRCm39) N3216S unknown Het
Cpeb2 T A 5: 43,391,455 (GRCm39) L217Q Het
Ctbp2 A T 7: 132,597,021 (GRCm39) N119K probably damaging Het
Des G T 1: 75,340,289 (GRCm39) V399L probably benign Het
Dnajc6 T C 4: 101,475,813 (GRCm39) V562A probably benign Het
Dusp13b T C 14: 21,791,155 (GRCm39) D99G probably benign Het
Ehd3 A G 17: 74,127,561 (GRCm39) I165V probably benign Het
Eme2 C T 17: 25,112,053 (GRCm39) V241M probably damaging Het
Eml5 A G 12: 98,810,376 (GRCm39) L860P possibly damaging Het
Eogt T A 6: 97,089,043 (GRCm39) K521M possibly damaging Het
Epb41l5 T C 1: 119,506,701 (GRCm39) T489A probably benign Het
Fmo5 G T 3: 97,558,802 (GRCm39) V421L probably benign Het
Gabpa C T 16: 84,653,403 (GRCm39) P268S probably benign Het
Gas2l3 G T 10: 89,262,315 (GRCm39) H136N probably benign Het
Gm5592 C T 7: 40,938,407 (GRCm39) A563V possibly damaging Het
Gpn3 A T 5: 122,519,508 (GRCm39) D205V probably benign Het
H13 T C 2: 152,522,999 (GRCm39) L104S probably damaging Het
H2-Q4 T A 17: 35,599,105 (GRCm39) V125E probably benign Het
Ifih1 A G 2: 62,442,242 (GRCm39) F374S probably damaging Het
Ildr2 A G 1: 166,131,158 (GRCm39) D338G probably damaging Het
Kmt2b A T 7: 30,281,893 (GRCm39) N1162K probably null Het
Lmntd1 T C 6: 145,359,256 (GRCm39) D298G probably damaging Het
Lrrc32 T A 7: 98,148,345 (GRCm39) V375E probably benign Het
Lrrc37a A C 11: 103,393,022 (GRCm39) I801R probably benign Het
Matcap1 A G 8: 106,008,775 (GRCm39) V414A probably damaging Het
Mgam A G 6: 40,657,121 (GRCm39) E935G probably benign Het
Mms22l A T 4: 24,588,238 (GRCm39) T917S probably damaging Het
Myo3a A T 2: 22,467,545 (GRCm39) E1204D possibly damaging Het
Nav3 T A 10: 109,550,243 (GRCm39) E1829V probably damaging Het
Nccrp1 C T 7: 28,245,632 (GRCm39) G150D probably damaging Het
Nlrp4b G T 7: 10,444,087 (GRCm39) W12L probably damaging Het
Nmb T C 7: 80,554,001 (GRCm39) T71A possibly damaging Het
Ogfod2 T A 5: 124,250,505 (GRCm39) H35Q probably benign Het
Ola1 A T 2: 72,929,732 (GRCm39) S290R probably damaging Het
Or1e30 T G 11: 73,678,281 (GRCm39) N172K probably benign Het
Or4k47 A T 2: 111,452,329 (GRCm39) I30N possibly damaging Het
Or51v15-ps1 T G 7: 103,278,543 (GRCm39) Y208S unknown Het
Or52e2 C A 7: 102,804,409 (GRCm39) E182* probably null Het
Or5p68 T G 7: 107,945,886 (GRCm39) T101P probably benign Het
Or9i14 A T 19: 13,792,099 (GRCm39) L285* probably null Het
Pcsk9 T C 4: 106,316,047 (GRCm39) D132G possibly damaging Het
Pkhd1 A T 1: 20,444,174 (GRCm39) V2296E probably damaging Het
Prl2c5 A T 13: 13,365,297 (GRCm39) I151L probably damaging Het
Prl3d3 A T 13: 27,344,931 (GRCm39) D101V possibly damaging Het
Prrt1 A G 17: 34,850,120 (GRCm39) Y178C probably damaging Het
Rasal1 A T 5: 120,793,155 (GRCm39) I87F possibly damaging Het
Rpgrip1l A T 8: 91,987,614 (GRCm39) Y814* probably null Het
Rpl3l T G 17: 24,951,447 (GRCm39) probably null Het
Rrbp1 C A 2: 143,853,161 (GRCm39) probably benign Het
Ryr3 A G 2: 112,483,364 (GRCm39) S4158P probably damaging Het
Scube2 G T 7: 109,398,515 (GRCm39) S951Y probably damaging Het
Sec14l1 T C 11: 117,041,002 (GRCm39) V396A probably benign Het
Sh3gl1 T A 17: 56,325,911 (GRCm39) K173* probably null Het
Shank3 A T 15: 89,388,521 (GRCm39) E371V probably damaging Het
Slc25a24 A G 3: 109,066,751 (GRCm39) T302A probably damaging Het
Slc25a41 A T 17: 57,348,580 (GRCm39) H4Q probably benign Het
Slc45a1 A T 4: 150,723,071 (GRCm39) V271D possibly damaging Het
Smad6 A T 9: 63,927,573 (GRCm39) L245Q probably damaging Het
Smad7 C A 18: 75,527,317 (GRCm39) Q388K probably damaging Het
Snx29 G T 16: 11,532,799 (GRCm39) D348Y possibly damaging Het
Son A T 16: 91,474,570 (GRCm39) H2418L unknown Het
Sppl3 G A 5: 115,233,922 (GRCm39) V331M probably damaging Het
St13 T G 15: 81,272,569 (GRCm39) T92P probably benign Het
St3gal4 A G 9: 34,963,643 (GRCm39) W222R probably damaging Het
Stk32a T A 18: 43,444,999 (GRCm39) N264K probably benign Het
Stoml3 T A 3: 53,405,397 (GRCm39) I26N possibly damaging Het
Taf7 T C 18: 37,776,021 (GRCm39) E182G probably damaging Het
Tas2r138 A G 6: 40,590,129 (GRCm39) V39A probably damaging Het
Tbc1d12 A G 19: 38,889,823 (GRCm39) S418G possibly damaging Het
Tbr1 T A 2: 61,642,723 (GRCm39) C663S probably benign Het
Tmc5 A T 7: 118,222,501 (GRCm39) Y67F probably benign Het
Tnfsf4 A C 1: 161,244,814 (GRCm39) I168L probably benign Het
Trav5-1 T G 14: 52,860,347 (GRCm39) S51A probably benign Het
Trmt10c A T 16: 55,854,646 (GRCm39) C330S possibly damaging Het
Trpm1 T C 7: 63,884,713 (GRCm39) M798T probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 115,958,998 (GRCm39) probably benign Het
Unc13d CATGCC CATGCCTCCGATGCC 11: 115,959,007 (GRCm39) probably benign Het
Vmn1r199 A G 13: 22,566,822 (GRCm39) T39A possibly damaging Het
Vmn1r74 T A 7: 11,580,999 (GRCm39) C100S possibly damaging Het
Vmn2r77 T A 7: 86,452,302 (GRCm39) I494K possibly damaging Het
Wdr17 G A 8: 55,112,654 (GRCm39) Q816* probably null Het
Other mutations in Dnah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dnah2 APN 11 69,383,498 (GRCm39) missense possibly damaging 0.93
IGL00418:Dnah2 APN 11 69,385,892 (GRCm39) splice site probably benign
IGL00772:Dnah2 APN 11 69,342,083 (GRCm39) missense probably damaging 0.97
IGL00819:Dnah2 APN 11 69,364,176 (GRCm39) critical splice donor site probably null
IGL00827:Dnah2 APN 11 69,339,283 (GRCm39) missense probably damaging 1.00
IGL01060:Dnah2 APN 11 69,368,918 (GRCm39) missense possibly damaging 0.86
IGL01340:Dnah2 APN 11 69,384,010 (GRCm39) missense probably damaging 0.99
IGL01349:Dnah2 APN 11 69,366,432 (GRCm39) missense probably damaging 0.99
IGL01413:Dnah2 APN 11 69,323,790 (GRCm39) missense probably damaging 0.99
IGL01451:Dnah2 APN 11 69,365,017 (GRCm39) splice site probably benign
IGL01480:Dnah2 APN 11 69,349,197 (GRCm39) missense possibly damaging 0.91
IGL01537:Dnah2 APN 11 69,406,906 (GRCm39) missense probably benign 0.17
IGL01592:Dnah2 APN 11 69,321,913 (GRCm39) missense probably benign 0.14
IGL01612:Dnah2 APN 11 69,355,889 (GRCm39) splice site probably benign
IGL01667:Dnah2 APN 11 69,435,221 (GRCm39) missense probably benign
IGL01667:Dnah2 APN 11 69,411,767 (GRCm39) missense probably damaging 0.98
IGL01691:Dnah2 APN 11 69,430,269 (GRCm39) missense probably benign
IGL02019:Dnah2 APN 11 69,365,111 (GRCm39) missense probably damaging 1.00
IGL02039:Dnah2 APN 11 69,390,038 (GRCm39) missense probably damaging 1.00
IGL02076:Dnah2 APN 11 69,313,385 (GRCm39) missense probably damaging 0.99
IGL02085:Dnah2 APN 11 69,349,011 (GRCm39) missense probably benign 0.07
IGL02158:Dnah2 APN 11 69,348,949 (GRCm39) missense probably benign
IGL02381:Dnah2 APN 11 69,337,118 (GRCm39) missense probably benign 0.25
IGL02681:Dnah2 APN 11 69,343,759 (GRCm39) missense probably benign 0.40
IGL02957:Dnah2 APN 11 69,339,333 (GRCm39) missense possibly damaging 0.96
IGL02961:Dnah2 APN 11 69,409,240 (GRCm39) missense probably damaging 1.00
IGL02969:Dnah2 APN 11 69,412,013 (GRCm39) missense possibly damaging 0.80
IGL03117:Dnah2 APN 11 69,327,117 (GRCm39) splice site probably benign
IGL03120:Dnah2 APN 11 69,312,674 (GRCm39) missense probably damaging 1.00
IGL03183:Dnah2 APN 11 69,349,314 (GRCm39) missense possibly damaging 0.94
IGL03197:Dnah2 APN 11 69,350,089 (GRCm39) missense probably damaging 1.00
IGL03263:Dnah2 APN 11 69,420,207 (GRCm39) critical splice donor site probably null
IGL03333:Dnah2 APN 11 69,385,949 (GRCm39) missense probably damaging 1.00
IGL03338:Dnah2 APN 11 69,387,403 (GRCm39) missense probably benign 0.13
argyrios UTSW 11 69,407,416 (GRCm39) missense possibly damaging 0.47
Aureus UTSW 11 69,320,174 (GRCm39) missense probably damaging 1.00
platinum UTSW 11 69,348,868 (GRCm39) missense probably damaging 0.96
R0334_dnah2_144 UTSW 11 69,327,662 (GRCm39) missense probably damaging 1.00
R2150_dnah2_212 UTSW 11 69,406,587 (GRCm39) missense probably benign 0.14
BB005:Dnah2 UTSW 11 69,321,661 (GRCm39) missense probably damaging 0.98
BB015:Dnah2 UTSW 11 69,321,661 (GRCm39) missense probably damaging 0.98
E0370:Dnah2 UTSW 11 69,406,441 (GRCm39) splice site probably null
P0026:Dnah2 UTSW 11 69,355,773 (GRCm39) missense probably damaging 1.00
R0133:Dnah2 UTSW 11 69,311,835 (GRCm39) missense probably damaging 1.00
R0190:Dnah2 UTSW 11 69,326,075 (GRCm39) missense probably damaging 1.00
R0334:Dnah2 UTSW 11 69,327,662 (GRCm39) missense probably damaging 1.00
R0359:Dnah2 UTSW 11 69,420,357 (GRCm39) missense probably benign 0.00
R0386:Dnah2 UTSW 11 69,338,687 (GRCm39) missense probably damaging 1.00
R0414:Dnah2 UTSW 11 69,390,064 (GRCm39) missense probably benign 0.26
R0427:Dnah2 UTSW 11 69,343,705 (GRCm39) missense probably damaging 0.99
R0433:Dnah2 UTSW 11 69,350,114 (GRCm39) missense probably damaging 1.00
R0442:Dnah2 UTSW 11 69,339,368 (GRCm39) missense probably damaging 1.00
R0462:Dnah2 UTSW 11 69,350,027 (GRCm39) missense probably damaging 1.00
R0463:Dnah2 UTSW 11 69,313,952 (GRCm39) missense probably damaging 1.00
R0611:Dnah2 UTSW 11 69,390,020 (GRCm39) missense probably damaging 1.00
R0626:Dnah2 UTSW 11 69,368,509 (GRCm39) missense probably benign 0.07
R0924:Dnah2 UTSW 11 69,312,134 (GRCm39) missense probably damaging 1.00
R0968:Dnah2 UTSW 11 69,339,345 (GRCm39) missense possibly damaging 0.67
R1066:Dnah2 UTSW 11 69,338,645 (GRCm39) missense probably damaging 1.00
R1183:Dnah2 UTSW 11 69,337,474 (GRCm39) missense possibly damaging 0.95
R1184:Dnah2 UTSW 11 69,390,016 (GRCm39) missense probably damaging 1.00
R1186:Dnah2 UTSW 11 69,406,526 (GRCm39) missense probably damaging 0.99
R1453:Dnah2 UTSW 11 69,341,876 (GRCm39) missense probably damaging 0.99
R1498:Dnah2 UTSW 11 69,411,493 (GRCm39) splice site probably null
R1538:Dnah2 UTSW 11 69,368,028 (GRCm39) missense probably benign 0.17
R1574:Dnah2 UTSW 11 69,405,514 (GRCm39) missense probably benign 0.26
R1574:Dnah2 UTSW 11 69,405,514 (GRCm39) missense probably benign 0.26
R1590:Dnah2 UTSW 11 69,412,024 (GRCm39) missense probably benign 0.00
R1590:Dnah2 UTSW 11 69,313,580 (GRCm39) critical splice donor site probably null
R1655:Dnah2 UTSW 11 69,364,680 (GRCm39) missense probably damaging 1.00
R1695:Dnah2 UTSW 11 69,405,517 (GRCm39) missense possibly damaging 0.74
R1726:Dnah2 UTSW 11 69,388,715 (GRCm39) missense probably damaging 1.00
R1764:Dnah2 UTSW 11 69,314,369 (GRCm39) missense probably damaging 1.00
R1815:Dnah2 UTSW 11 69,366,400 (GRCm39) missense probably damaging 1.00
R1822:Dnah2 UTSW 11 69,405,630 (GRCm39) missense probably damaging 1.00
R1859:Dnah2 UTSW 11 69,328,712 (GRCm39) missense probably damaging 0.99
R1911:Dnah2 UTSW 11 69,406,578 (GRCm39) missense possibly damaging 0.64
R1913:Dnah2 UTSW 11 69,355,756 (GRCm39) missense probably damaging 1.00
R1981:Dnah2 UTSW 11 69,365,151 (GRCm39) missense probably damaging 1.00
R2010:Dnah2 UTSW 11 69,349,184 (GRCm39) critical splice donor site probably null
R2016:Dnah2 UTSW 11 69,327,896 (GRCm39) missense probably damaging 0.97
R2017:Dnah2 UTSW 11 69,327,896 (GRCm39) missense probably damaging 0.97
R2044:Dnah2 UTSW 11 69,415,066 (GRCm39) missense probably benign 0.14
R2077:Dnah2 UTSW 11 69,387,432 (GRCm39) missense possibly damaging 0.73
R2096:Dnah2 UTSW 11 69,346,742 (GRCm39) missense probably damaging 0.98
R2099:Dnah2 UTSW 11 69,384,063 (GRCm39) missense probably damaging 1.00
R2127:Dnah2 UTSW 11 69,349,011 (GRCm39) missense probably benign 0.02
R2128:Dnah2 UTSW 11 69,349,011 (GRCm39) missense probably benign 0.02
R2146:Dnah2 UTSW 11 69,406,587 (GRCm39) missense probably benign 0.14
R2147:Dnah2 UTSW 11 69,406,587 (GRCm39) missense probably benign 0.14
R2150:Dnah2 UTSW 11 69,406,587 (GRCm39) missense probably benign 0.14
R2404:Dnah2 UTSW 11 69,328,047 (GRCm39) missense probably damaging 0.99
R2510:Dnah2 UTSW 11 69,415,032 (GRCm39) nonsense probably null
R2517:Dnah2 UTSW 11 69,407,470 (GRCm39) missense probably damaging 1.00
R3014:Dnah2 UTSW 11 69,321,304 (GRCm39) missense probably benign
R3741:Dnah2 UTSW 11 69,339,295 (GRCm39) missense probably damaging 1.00
R3814:Dnah2 UTSW 11 69,383,476 (GRCm39) splice site probably null
R3872:Dnah2 UTSW 11 69,320,174 (GRCm39) missense probably damaging 1.00
R3873:Dnah2 UTSW 11 69,320,174 (GRCm39) missense probably damaging 1.00
R3874:Dnah2 UTSW 11 69,320,174 (GRCm39) missense probably damaging 1.00
R3875:Dnah2 UTSW 11 69,320,174 (GRCm39) missense probably damaging 1.00
R3881:Dnah2 UTSW 11 69,342,173 (GRCm39) missense possibly damaging 0.94
R3953:Dnah2 UTSW 11 69,344,929 (GRCm39) missense probably damaging 1.00
R3956:Dnah2 UTSW 11 69,374,847 (GRCm39) missense probably benign 0.00
R4501:Dnah2 UTSW 11 69,368,485 (GRCm39) missense probably benign
R4515:Dnah2 UTSW 11 69,356,457 (GRCm39) missense possibly damaging 0.61
R4612:Dnah2 UTSW 11 69,374,193 (GRCm39) missense possibly damaging 0.93
R4625:Dnah2 UTSW 11 69,354,487 (GRCm39) missense probably damaging 1.00
R4627:Dnah2 UTSW 11 69,356,202 (GRCm39) missense probably damaging 1.00
R4642:Dnah2 UTSW 11 69,387,385 (GRCm39) missense probably benign 0.00
R4683:Dnah2 UTSW 11 69,349,768 (GRCm39) missense probably damaging 1.00
R4698:Dnah2 UTSW 11 69,389,358 (GRCm39) missense probably damaging 1.00
R4710:Dnah2 UTSW 11 69,368,903 (GRCm39) missense probably damaging 1.00
R4712:Dnah2 UTSW 11 69,407,416 (GRCm39) missense possibly damaging 0.47
R4713:Dnah2 UTSW 11 69,367,514 (GRCm39) missense probably damaging 1.00
R4717:Dnah2 UTSW 11 69,320,183 (GRCm39) missense probably benign 0.00
R4740:Dnah2 UTSW 11 69,348,868 (GRCm39) missense probably damaging 0.96
R4780:Dnah2 UTSW 11 69,364,697 (GRCm39) missense probably damaging 0.97
R4825:Dnah2 UTSW 11 69,314,031 (GRCm39) missense probably damaging 1.00
R4864:Dnah2 UTSW 11 69,313,416 (GRCm39) missense probably damaging 0.98
R4868:Dnah2 UTSW 11 69,354,474 (GRCm39) missense probably damaging 1.00
R4879:Dnah2 UTSW 11 69,367,517 (GRCm39) missense probably damaging 1.00
R4908:Dnah2 UTSW 11 69,411,973 (GRCm39) missense probably benign 0.00
R4911:Dnah2 UTSW 11 69,389,930 (GRCm39) critical splice donor site probably null
R4954:Dnah2 UTSW 11 69,430,322 (GRCm39) missense possibly damaging 0.61
R4962:Dnah2 UTSW 11 69,346,799 (GRCm39) nonsense probably null
R5015:Dnah2 UTSW 11 69,388,708 (GRCm39) missense possibly damaging 0.89
R5049:Dnah2 UTSW 11 69,338,992 (GRCm39) missense probably damaging 1.00
R5055:Dnah2 UTSW 11 69,411,599 (GRCm39) missense possibly damaging 0.67
R5153:Dnah2 UTSW 11 69,411,759 (GRCm39) missense possibly damaging 0.84
R5155:Dnah2 UTSW 11 69,313,362 (GRCm39) missense probably damaging 1.00
R5186:Dnah2 UTSW 11 69,326,710 (GRCm39) missense probably damaging 1.00
R5187:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5208:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5252:Dnah2 UTSW 11 69,420,295 (GRCm39) missense probably damaging 0.98
R5296:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5298:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5299:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5301:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5324:Dnah2 UTSW 11 69,348,819 (GRCm39) missense probably benign 0.07
R5350:Dnah2 UTSW 11 69,406,862 (GRCm39) missense possibly damaging 0.48
R5377:Dnah2 UTSW 11 69,312,674 (GRCm39) missense probably damaging 1.00
R5393:Dnah2 UTSW 11 69,391,683 (GRCm39) missense probably benign
R5421:Dnah2 UTSW 11 69,326,462 (GRCm39) missense probably damaging 1.00
R5452:Dnah2 UTSW 11 69,415,209 (GRCm39) missense probably damaging 1.00
R5461:Dnah2 UTSW 11 69,364,177 (GRCm39) critical splice donor site probably null
R5474:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5476:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5477:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5510:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5527:Dnah2 UTSW 11 69,328,014 (GRCm39) nonsense probably null
R5566:Dnah2 UTSW 11 69,407,395 (GRCm39) nonsense probably null
R5587:Dnah2 UTSW 11 69,328,068 (GRCm39) missense probably damaging 1.00
R5628:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5688:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5690:Dnah2 UTSW 11 69,382,370 (GRCm39) missense probably benign 0.15
R5711:Dnah2 UTSW 11 69,326,216 (GRCm39) missense probably damaging 1.00
R5735:Dnah2 UTSW 11 69,321,643 (GRCm39) missense possibly damaging 0.93
R5826:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5913:Dnah2 UTSW 11 69,339,256 (GRCm39) missense probably damaging 1.00
R5914:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5960:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5961:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5961:Dnah2 UTSW 11 69,321,974 (GRCm39) missense probably damaging 1.00
R5977:Dnah2 UTSW 11 69,411,707 (GRCm39) missense possibly damaging 0.79
R6020:Dnah2 UTSW 11 69,391,665 (GRCm39) missense probably benign
R6036:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R6036:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R6050:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R6086:Dnah2 UTSW 11 69,406,834 (GRCm39) missense probably benign 0.30
R6115:Dnah2 UTSW 11 69,337,475 (GRCm39) missense probably damaging 1.00
R6123:Dnah2 UTSW 11 69,409,185 (GRCm39) missense probably benign 0.29
R6159:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R6159:Dnah2 UTSW 11 69,349,368 (GRCm39) missense probably damaging 1.00
R6163:Dnah2 UTSW 11 69,411,729 (GRCm39) nonsense probably null
R6171:Dnah2 UTSW 11 69,313,868 (GRCm39) missense probably damaging 1.00
R6263:Dnah2 UTSW 11 69,348,238 (GRCm39) missense probably damaging 1.00
R6298:Dnah2 UTSW 11 69,382,467 (GRCm39) missense probably benign 0.25
R6352:Dnah2 UTSW 11 69,339,053 (GRCm39) missense probably damaging 1.00
R6399:Dnah2 UTSW 11 69,349,344 (GRCm39) missense probably damaging 0.98
R6466:Dnah2 UTSW 11 69,430,241 (GRCm39) missense probably benign
R6478:Dnah2 UTSW 11 69,406,836 (GRCm39) missense probably benign 0.01
R6516:Dnah2 UTSW 11 69,356,212 (GRCm39) missense probably benign 0.34
R6538:Dnah2 UTSW 11 69,328,023 (GRCm39) missense possibly damaging 0.87
R6802:Dnah2 UTSW 11 69,314,516 (GRCm39) missense probably damaging 1.00
R6861:Dnah2 UTSW 11 69,346,789 (GRCm39) missense possibly damaging 0.64
R6869:Dnah2 UTSW 11 69,320,297 (GRCm39) missense probably damaging 1.00
R6894:Dnah2 UTSW 11 69,375,086 (GRCm39) missense probably benign 0.12
R6935:Dnah2 UTSW 11 69,312,567 (GRCm39) missense probably damaging 1.00
R7017:Dnah2 UTSW 11 69,382,373 (GRCm39) nonsense probably null
R7073:Dnah2 UTSW 11 69,321,318 (GRCm39) nonsense probably null
R7111:Dnah2 UTSW 11 69,337,579 (GRCm39) splice site probably null
R7125:Dnah2 UTSW 11 69,327,008 (GRCm39) missense probably damaging 0.99
R7137:Dnah2 UTSW 11 69,382,381 (GRCm39) missense probably damaging 1.00
R7190:Dnah2 UTSW 11 69,439,923 (GRCm39) splice site probably null
R7214:Dnah2 UTSW 11 69,321,935 (GRCm39) missense probably damaging 1.00
R7227:Dnah2 UTSW 11 69,312,222 (GRCm39) missense probably damaging 0.99
R7238:Dnah2 UTSW 11 69,349,972 (GRCm39) critical splice donor site probably null
R7256:Dnah2 UTSW 11 69,321,920 (GRCm39) missense probably damaging 1.00
R7267:Dnah2 UTSW 11 69,391,643 (GRCm39) missense probably damaging 1.00
R7420:Dnah2 UTSW 11 69,369,623 (GRCm39) missense possibly damaging 0.94
R7421:Dnah2 UTSW 11 69,383,631 (GRCm39) missense probably benign 0.25
R7437:Dnah2 UTSW 11 69,389,453 (GRCm39) missense probably damaging 1.00
R7461:Dnah2 UTSW 11 69,439,816 (GRCm39) critical splice donor site probably null
R7473:Dnah2 UTSW 11 69,382,484 (GRCm39) missense probably damaging 0.99
R7528:Dnah2 UTSW 11 69,391,622 (GRCm39) missense probably damaging 0.99
R7613:Dnah2 UTSW 11 69,439,816 (GRCm39) critical splice donor site probably null
R7615:Dnah2 UTSW 11 69,326,130 (GRCm39) missense probably damaging 0.99
R7626:Dnah2 UTSW 11 69,389,511 (GRCm39) missense probably damaging 0.99
R7745:Dnah2 UTSW 11 69,342,144 (GRCm39) nonsense probably null
R7764:Dnah2 UTSW 11 69,348,984 (GRCm39) missense probably benign 0.29
R7793:Dnah2 UTSW 11 69,386,040 (GRCm39) missense probably benign 0.00
R7819:Dnah2 UTSW 11 69,407,419 (GRCm39) missense probably benign 0.01
R7881:Dnah2 UTSW 11 69,322,064 (GRCm39) missense probably damaging 1.00
R7900:Dnah2 UTSW 11 69,409,254 (GRCm39) missense probably damaging 1.00
R7916:Dnah2 UTSW 11 69,311,974 (GRCm39) critical splice acceptor site probably null
R7921:Dnah2 UTSW 11 69,411,660 (GRCm39) missense probably benign
R7928:Dnah2 UTSW 11 69,321,661 (GRCm39) missense probably damaging 0.98
R7937:Dnah2 UTSW 11 69,408,511 (GRCm39) nonsense probably null
R7995:Dnah2 UTSW 11 69,411,563 (GRCm39) missense possibly damaging 0.77
R8202:Dnah2 UTSW 11 69,369,649 (GRCm39) missense probably benign 0.00
R8208:Dnah2 UTSW 11 69,411,678 (GRCm39) missense probably benign 0.05
R8215:Dnah2 UTSW 11 69,326,193 (GRCm39) missense probably damaging 1.00
R8279:Dnah2 UTSW 11 69,366,399 (GRCm39) missense probably damaging 1.00
R8338:Dnah2 UTSW 11 69,378,122 (GRCm39) missense probably damaging 1.00
R8348:Dnah2 UTSW 11 69,320,273 (GRCm39) missense possibly damaging 0.95
R8405:Dnah2 UTSW 11 69,349,289 (GRCm39) missense probably damaging 1.00
R8407:Dnah2 UTSW 11 69,350,104 (GRCm39) missense probably benign 0.00
R8493:Dnah2 UTSW 11 69,343,804 (GRCm39) missense probably damaging 1.00
R8673:Dnah2 UTSW 11 69,405,523 (GRCm39) missense probably benign 0.23
R8725:Dnah2 UTSW 11 69,415,005 (GRCm39) missense probably damaging 1.00
R8727:Dnah2 UTSW 11 69,415,005 (GRCm39) missense probably damaging 1.00
R8730:Dnah2 UTSW 11 69,384,087 (GRCm39) missense possibly damaging 0.73
R8804:Dnah2 UTSW 11 69,356,511 (GRCm39) missense probably benign 0.01
R8876:Dnah2 UTSW 11 69,382,348 (GRCm39) missense probably damaging 1.00
R8894:Dnah2 UTSW 11 69,383,048 (GRCm39) missense probably benign 0.01
R8938:Dnah2 UTSW 11 69,328,754 (GRCm39) missense probably damaging 0.99
R9044:Dnah2 UTSW 11 69,420,247 (GRCm39) missense probably benign
R9085:Dnah2 UTSW 11 69,320,224 (GRCm39) missense possibly damaging 0.69
R9110:Dnah2 UTSW 11 69,435,208 (GRCm39) missense probably benign
R9156:Dnah2 UTSW 11 69,313,687 (GRCm39) missense
R9251:Dnah2 UTSW 11 69,406,619 (GRCm39) missense probably damaging 1.00
R9279:Dnah2 UTSW 11 69,409,104 (GRCm39) missense probably benign 0.01
R9318:Dnah2 UTSW 11 69,375,155 (GRCm39) missense probably benign 0.07
R9321:Dnah2 UTSW 11 69,338,939 (GRCm39) critical splice donor site probably null
R9350:Dnah2 UTSW 11 69,384,073 (GRCm39) missense probably benign 0.10
R9358:Dnah2 UTSW 11 69,406,592 (GRCm39) missense probably damaging 0.99
R9417:Dnah2 UTSW 11 69,326,990 (GRCm39) missense probably damaging 1.00
R9420:Dnah2 UTSW 11 69,368,942 (GRCm39) missense probably benign 0.09
R9438:Dnah2 UTSW 11 69,364,220 (GRCm39) missense probably damaging 1.00
R9469:Dnah2 UTSW 11 69,321,896 (GRCm39) missense probably damaging 1.00
R9487:Dnah2 UTSW 11 69,406,617 (GRCm39) missense possibly damaging 0.47
R9495:Dnah2 UTSW 11 69,345,208 (GRCm39) missense possibly damaging 0.89
R9579:Dnah2 UTSW 11 69,368,041 (GRCm39) missense probably damaging 1.00
R9608:Dnah2 UTSW 11 69,344,888 (GRCm39) missense probably null 1.00
R9651:Dnah2 UTSW 11 69,341,824 (GRCm39) critical splice donor site probably null
R9662:Dnah2 UTSW 11 69,343,763 (GRCm39) missense probably benign
RF004:Dnah2 UTSW 11 69,328,013 (GRCm39) missense probably benign 0.24
U24488:Dnah2 UTSW 11 69,374,648 (GRCm39) missense probably damaging 0.99
X0021:Dnah2 UTSW 11 69,339,388 (GRCm39) missense possibly damaging 0.81
Z1088:Dnah2 UTSW 11 69,321,619 (GRCm39) missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69,312,647 (GRCm39) missense possibly damaging 0.46
Z1176:Dnah2 UTSW 11 69,407,349 (GRCm39) missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69,407,307 (GRCm39) missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69,389,493 (GRCm39) missense probably benign 0.12
Z1176:Dnah2 UTSW 11 69,377,880 (GRCm39) missense possibly damaging 0.46
Z1176:Dnah2 UTSW 11 69,341,946 (GRCm39) missense probably benign
Z1177:Dnah2 UTSW 11 69,435,383 (GRCm39) critical splice acceptor site probably null
Z1177:Dnah2 UTSW 11 69,354,279 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AAGATAGCACGCGTCCATG -3'
(R):5'- CATGCAGAGCAGAGTTAGGC -3'

Sequencing Primer
(F):5'- GCGTCCATGCACAGAAGC -3'
(R):5'- AGTTAGGCTCTCCTGTGTAGATG -3'
Posted On 2022-03-25