Incidental Mutation 'R9258:Unc13d'
ID 702047
Institutional Source Beutler Lab
Gene Symbol Unc13d
Ensembl Gene ENSMUSG00000057948
Gene Name unc-13 homolog D
Synonyms Jinx, 2610108D09Rik, Munc13-4
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.120) question?
Stock # R9258 (G1)
Quality Score 217.468
Status Not validated
Chromosome 11
Chromosomal Location 115952921-115968787 bp(-) (GRCm39)
Type of Mutation small insertion (3 aa in frame mutation)
DNA Base Change (assembly) AATGCCTCCCATGCC to AATGCCTCCCATGCCTCCCATGCC at 115958998 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075036] [ENSMUST00000106450] [ENSMUST00000106451] [ENSMUST00000173345] [ENSMUST00000174822]
AlphaFold B2RUP2
Predicted Effect probably benign
Transcript: ENSMUST00000075036
SMART Domains Protein: ENSMUSP00000074549
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 585 735 8e-6 PDB
low complexity region 738 751 N/A INTRINSIC
Pfam:Membr_traf_MHD 785 892 1.9e-25 PFAM
C2 923 1031 7.93e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106450
SMART Domains Protein: ENSMUSP00000102058
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 8e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Pfam:Membr_traf_MHD 787 894 1.9e-25 PFAM
C2 925 1033 7.93e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106451
SMART Domains Protein: ENSMUSP00000102059
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 8e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Pfam:Membr_traf_MHD 788 838 7.1e-10 PFAM
Pfam:Membr_traf_MHD 830 893 1.4e-15 PFAM
C2 925 1033 7.93e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173345
SMART Domains Protein: ENSMUSP00000133679
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 5e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174822
SMART Domains Protein: ENSMUSP00000134260
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 585 735 8e-6 PDB
low complexity region 738 751 N/A INTRINSIC
Pfam:Membr_traf_MHD 785 892 1.9e-25 PFAM
C2 923 1031 7.93e-10 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the UNC13 family, containing similar domain structure as other family members but lacking an N-terminal phorbol ester-binding C1 domain present in other Munc13 proteins. The protein appears to play a role in vesicle maturation during exocytosis and is involved in regulation of cytolytic granules secretion. Mutations in this gene are associated with familial hemophagocytic lymphohistiocytosis type 3, a genetically heterogeneous, rare autosomal recessive disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted deletion of this gene leads to defective hemostasis, abrogated thrombus formation and protection of homozygotes from ischemic stroke in the absence of intracranial bleeding. Homozygous ENU mutant mice are sensitive to infection by mouse cytomegalovirus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 T A 8: 124,709,347 (GRCm39) Q69L probably benign Het
Abtb2 A C 2: 103,546,410 (GRCm39) Q930P probably null Het
Adam18 G A 8: 25,158,574 (GRCm39) T73I probably benign Het
Ankrd54 A T 15: 78,946,996 (GRCm39) M1K probably null Het
Anks1 T C 17: 28,277,400 (GRCm39) V1106A probably damaging Het
Aox1 A T 1: 58,351,515 (GRCm39) I701F probably damaging Het
Arfgef3 C T 10: 18,465,387 (GRCm39) R2152H probably damaging Het
Arnt2 C T 7: 84,010,798 (GRCm39) G37E probably damaging Het
Arpp21 G A 9: 111,953,956 (GRCm39) T581M probably benign Het
Arvcf A G 16: 18,216,957 (GRCm39) N428S probably damaging Het
C2cd3 A G 7: 100,098,026 (GRCm39) E1471G Het
Cadm1 A G 9: 47,710,730 (GRCm39) K211R probably benign Het
Cdh6 A G 15: 13,064,462 (GRCm39) S143P probably damaging Het
Cep152 G A 2: 125,421,356 (GRCm39) Q1125* probably null Het
Cfap54 A C 10: 92,770,960 (GRCm39) S2095A unknown Het
Col12a1 T C 9: 79,613,645 (GRCm39) T67A probably benign Het
Col6a3 T C 1: 90,700,703 (GRCm39) N3216S unknown Het
Cpeb2 T A 5: 43,391,455 (GRCm39) L217Q Het
Ctbp2 A T 7: 132,597,021 (GRCm39) N119K probably damaging Het
Des G T 1: 75,340,289 (GRCm39) V399L probably benign Het
Dnah2 G T 11: 69,368,079 (GRCm39) H1753Q probably damaging Het
Dnajc6 T C 4: 101,475,813 (GRCm39) V562A probably benign Het
Dusp13b T C 14: 21,791,155 (GRCm39) D99G probably benign Het
Ehd3 A G 17: 74,127,561 (GRCm39) I165V probably benign Het
Eme2 C T 17: 25,112,053 (GRCm39) V241M probably damaging Het
Eml5 A G 12: 98,810,376 (GRCm39) L860P possibly damaging Het
Eogt T A 6: 97,089,043 (GRCm39) K521M possibly damaging Het
Epb41l5 T C 1: 119,506,701 (GRCm39) T489A probably benign Het
Fmo5 G T 3: 97,558,802 (GRCm39) V421L probably benign Het
Gabpa C T 16: 84,653,403 (GRCm39) P268S probably benign Het
Gas2l3 G T 10: 89,262,315 (GRCm39) H136N probably benign Het
Gm5592 C T 7: 40,938,407 (GRCm39) A563V possibly damaging Het
Gpn3 A T 5: 122,519,508 (GRCm39) D205V probably benign Het
H13 T C 2: 152,522,999 (GRCm39) L104S probably damaging Het
H2-Q4 T A 17: 35,599,105 (GRCm39) V125E probably benign Het
Ifih1 A G 2: 62,442,242 (GRCm39) F374S probably damaging Het
Ildr2 A G 1: 166,131,158 (GRCm39) D338G probably damaging Het
Kmt2b A T 7: 30,281,893 (GRCm39) N1162K probably null Het
Lmntd1 T C 6: 145,359,256 (GRCm39) D298G probably damaging Het
Lrrc32 T A 7: 98,148,345 (GRCm39) V375E probably benign Het
Lrrc37a A C 11: 103,393,022 (GRCm39) I801R probably benign Het
Matcap1 A G 8: 106,008,775 (GRCm39) V414A probably damaging Het
Mgam A G 6: 40,657,121 (GRCm39) E935G probably benign Het
Mms22l A T 4: 24,588,238 (GRCm39) T917S probably damaging Het
Myo3a A T 2: 22,467,545 (GRCm39) E1204D possibly damaging Het
Nav3 T A 10: 109,550,243 (GRCm39) E1829V probably damaging Het
Nccrp1 C T 7: 28,245,632 (GRCm39) G150D probably damaging Het
Nlrp4b G T 7: 10,444,087 (GRCm39) W12L probably damaging Het
Nmb T C 7: 80,554,001 (GRCm39) T71A possibly damaging Het
Ogfod2 T A 5: 124,250,505 (GRCm39) H35Q probably benign Het
Ola1 A T 2: 72,929,732 (GRCm39) S290R probably damaging Het
Or1e30 T G 11: 73,678,281 (GRCm39) N172K probably benign Het
Or4k47 A T 2: 111,452,329 (GRCm39) I30N possibly damaging Het
Or51v15-ps1 T G 7: 103,278,543 (GRCm39) Y208S unknown Het
Or52e2 C A 7: 102,804,409 (GRCm39) E182* probably null Het
Or5p68 T G 7: 107,945,886 (GRCm39) T101P probably benign Het
Or9i14 A T 19: 13,792,099 (GRCm39) L285* probably null Het
Pcsk9 T C 4: 106,316,047 (GRCm39) D132G possibly damaging Het
Pkhd1 A T 1: 20,444,174 (GRCm39) V2296E probably damaging Het
Prl2c5 A T 13: 13,365,297 (GRCm39) I151L probably damaging Het
Prl3d3 A T 13: 27,344,931 (GRCm39) D101V possibly damaging Het
Prrt1 A G 17: 34,850,120 (GRCm39) Y178C probably damaging Het
Rasal1 A T 5: 120,793,155 (GRCm39) I87F possibly damaging Het
Rpgrip1l A T 8: 91,987,614 (GRCm39) Y814* probably null Het
Rpl3l T G 17: 24,951,447 (GRCm39) probably null Het
Rrbp1 C A 2: 143,853,161 (GRCm39) probably benign Het
Ryr3 A G 2: 112,483,364 (GRCm39) S4158P probably damaging Het
Scube2 G T 7: 109,398,515 (GRCm39) S951Y probably damaging Het
Sec14l1 T C 11: 117,041,002 (GRCm39) V396A probably benign Het
Sh3gl1 T A 17: 56,325,911 (GRCm39) K173* probably null Het
Shank3 A T 15: 89,388,521 (GRCm39) E371V probably damaging Het
Slc25a24 A G 3: 109,066,751 (GRCm39) T302A probably damaging Het
Slc25a41 A T 17: 57,348,580 (GRCm39) H4Q probably benign Het
Slc45a1 A T 4: 150,723,071 (GRCm39) V271D possibly damaging Het
Smad6 A T 9: 63,927,573 (GRCm39) L245Q probably damaging Het
Smad7 C A 18: 75,527,317 (GRCm39) Q388K probably damaging Het
Snx29 G T 16: 11,532,799 (GRCm39) D348Y possibly damaging Het
Son A T 16: 91,474,570 (GRCm39) H2418L unknown Het
Sppl3 G A 5: 115,233,922 (GRCm39) V331M probably damaging Het
St13 T G 15: 81,272,569 (GRCm39) T92P probably benign Het
St3gal4 A G 9: 34,963,643 (GRCm39) W222R probably damaging Het
Stk32a T A 18: 43,444,999 (GRCm39) N264K probably benign Het
Stoml3 T A 3: 53,405,397 (GRCm39) I26N possibly damaging Het
Taf7 T C 18: 37,776,021 (GRCm39) E182G probably damaging Het
Tas2r138 A G 6: 40,590,129 (GRCm39) V39A probably damaging Het
Tbc1d12 A G 19: 38,889,823 (GRCm39) S418G possibly damaging Het
Tbr1 T A 2: 61,642,723 (GRCm39) C663S probably benign Het
Tmc5 A T 7: 118,222,501 (GRCm39) Y67F probably benign Het
Tnfsf4 A C 1: 161,244,814 (GRCm39) I168L probably benign Het
Trav5-1 T G 14: 52,860,347 (GRCm39) S51A probably benign Het
Trmt10c A T 16: 55,854,646 (GRCm39) C330S possibly damaging Het
Trpm1 T C 7: 63,884,713 (GRCm39) M798T probably benign Het
Vmn1r199 A G 13: 22,566,822 (GRCm39) T39A possibly damaging Het
Vmn1r74 T A 7: 11,580,999 (GRCm39) C100S possibly damaging Het
Vmn2r77 T A 7: 86,452,302 (GRCm39) I494K possibly damaging Het
Wdr17 G A 8: 55,112,654 (GRCm39) Q816* probably null Het
Other mutations in Unc13d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Unc13d APN 11 115,965,229 (GRCm39) missense probably damaging 0.99
IGL00976:Unc13d APN 11 115,961,293 (GRCm39) missense probably damaging 1.00
IGL01630:Unc13d APN 11 115,964,692 (GRCm39) missense probably benign 0.00
IGL01761:Unc13d APN 11 115,964,695 (GRCm39) missense probably damaging 1.00
IGL01772:Unc13d APN 11 115,967,358 (GRCm39) missense possibly damaging 0.91
IGL01935:Unc13d APN 11 115,960,577 (GRCm39) missense probably benign
IGL02486:Unc13d APN 11 115,960,632 (GRCm39) splice site probably benign
IGL02503:Unc13d APN 11 115,959,628 (GRCm39) missense possibly damaging 0.82
IGL02519:Unc13d APN 11 115,961,359 (GRCm39) missense probably damaging 1.00
IGL02524:Unc13d APN 11 115,961,145 (GRCm39) missense probably damaging 1.00
IGL02634:Unc13d APN 11 115,961,382 (GRCm39) splice site probably benign
IGL02636:Unc13d APN 11 115,964,444 (GRCm39) missense probably damaging 1.00
IGL03243:Unc13d APN 11 115,958,670 (GRCm39) missense probably benign 0.34
jinx UTSW 11 115,964,249 (GRCm39) unclassified probably benign
R0033:Unc13d UTSW 11 115,959,991 (GRCm39) missense probably benign 0.00
R0084:Unc13d UTSW 11 115,954,657 (GRCm39) missense probably damaging 1.00
R0122:Unc13d UTSW 11 115,956,308 (GRCm39) missense probably benign 0.00
R0422:Unc13d UTSW 11 115,960,846 (GRCm39) critical splice donor site probably null
R0666:Unc13d UTSW 11 115,960,318 (GRCm39) splice site probably benign
R1019:Unc13d UTSW 11 115,958,900 (GRCm39) missense probably benign 0.03
R1333:Unc13d UTSW 11 115,964,381 (GRCm39) splice site probably benign
R1484:Unc13d UTSW 11 115,964,701 (GRCm39) missense possibly damaging 0.72
R1594:Unc13d UTSW 11 115,959,538 (GRCm39) missense probably benign 0.04
R1597:Unc13d UTSW 11 115,965,262 (GRCm39) missense probably benign 0.02
R1603:Unc13d UTSW 11 115,964,481 (GRCm39) missense possibly damaging 0.86
R1662:Unc13d UTSW 11 115,959,499 (GRCm39) missense probably null 1.00
R1909:Unc13d UTSW 11 115,961,121 (GRCm39) missense probably damaging 0.99
R2015:Unc13d UTSW 11 115,959,581 (GRCm39) missense probably damaging 1.00
R2313:Unc13d UTSW 11 115,954,560 (GRCm39) missense probably damaging 1.00
R2435:Unc13d UTSW 11 115,959,514 (GRCm39) missense probably damaging 1.00
R4705:Unc13d UTSW 11 115,964,214 (GRCm39) missense possibly damaging 0.70
R4732:Unc13d UTSW 11 115,964,408 (GRCm39) missense possibly damaging 0.91
R4733:Unc13d UTSW 11 115,964,408 (GRCm39) missense possibly damaging 0.91
R4792:Unc13d UTSW 11 115,961,108 (GRCm39) missense probably damaging 1.00
R4843:Unc13d UTSW 11 115,965,085 (GRCm39) missense probably damaging 1.00
R5496:Unc13d UTSW 11 115,957,534 (GRCm39) missense probably damaging 1.00
R5571:Unc13d UTSW 11 115,954,480 (GRCm39) missense probably benign 0.00
R5589:Unc13d UTSW 11 115,960,579 (GRCm39) missense probably damaging 0.99
R5838:Unc13d UTSW 11 115,955,451 (GRCm39) missense possibly damaging 0.80
R6058:Unc13d UTSW 11 115,964,394 (GRCm39) critical splice donor site probably null
R6266:Unc13d UTSW 11 115,959,064 (GRCm39) missense probably damaging 1.00
R6807:Unc13d UTSW 11 115,957,577 (GRCm39) missense probably damaging 0.98
R7085:Unc13d UTSW 11 115,955,633 (GRCm39) missense probably benign 0.07
R7098:Unc13d UTSW 11 115,954,552 (GRCm39) missense probably damaging 1.00
R7269:Unc13d UTSW 11 115,959,056 (GRCm39) missense probably benign 0.01
R7291:Unc13d UTSW 11 115,964,876 (GRCm39) missense possibly damaging 0.79
R7453:Unc13d UTSW 11 115,958,697 (GRCm39) missense probably benign
R7486:Unc13d UTSW 11 115,965,259 (GRCm39) missense possibly damaging 0.68
R7618:Unc13d UTSW 11 115,957,547 (GRCm39) missense probably damaging 1.00
R7817:Unc13d UTSW 11 115,967,109 (GRCm39) missense probably damaging 1.00
R8290:Unc13d UTSW 11 115,958,973 (GRCm39) missense probably damaging 0.97
R8442:Unc13d UTSW 11 115,958,657 (GRCm39) missense probably damaging 0.99
R8817:Unc13d UTSW 11 115,958,998 (GRCm39) small insertion probably benign
R8818:Unc13d UTSW 11 115,958,998 (GRCm39) small insertion probably benign
R8820:Unc13d UTSW 11 115,958,998 (GRCm39) small insertion probably benign
R8821:Unc13d UTSW 11 115,958,998 (GRCm39) small insertion probably benign
R8858:Unc13d UTSW 11 115,953,618 (GRCm39) missense probably damaging 1.00
R9031:Unc13d UTSW 11 115,958,998 (GRCm39) small insertion probably benign
R9066:Unc13d UTSW 11 115,957,561 (GRCm39) missense probably benign 0.07
R9084:Unc13d UTSW 11 115,958,998 (GRCm39) small insertion probably benign
R9085:Unc13d UTSW 11 115,958,998 (GRCm39) small insertion probably benign
R9258:Unc13d UTSW 11 115,959,007 (GRCm39) small insertion probably benign
R9259:Unc13d UTSW 11 115,958,998 (GRCm39) small insertion probably benign
R9260:Unc13d UTSW 11 115,958,998 (GRCm39) small insertion probably benign
R9396:Unc13d UTSW 11 115,966,529 (GRCm39) critical splice donor site probably null
R9612:Unc13d UTSW 11 115,961,144 (GRCm39) nonsense probably null
R9648:Unc13d UTSW 11 115,958,998 (GRCm39) small insertion probably benign
R9649:Unc13d UTSW 11 115,958,998 (GRCm39) small insertion probably benign
R9650:Unc13d UTSW 11 115,958,998 (GRCm39) small insertion probably benign
X0027:Unc13d UTSW 11 115,960,582 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGGGATAGACATCAGCTCAG -3'
(R):5'- CTGACATGGTAAGACCCAGAGC -3'

Sequencing Primer
(F):5'- GATAGACATCAGCTCAGGTCCTACTG -3'
(R):5'- CCAGAGCTGGGGTTGAGG -3'
Posted On 2022-03-25