Incidental Mutation 'R9258:Eml5'
ID 702050
Institutional Source Beutler Lab
Gene Symbol Eml5
Ensembl Gene ENSMUSG00000051166
Gene Name echinoderm microtubule associated protein like 5
Synonyms C130068M19Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.334) question?
Stock # R9258 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 98786805-98901484 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98844117 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 860 (L860P)
Ref Sequence ENSEMBL: ENSMUSP00000152709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]
AlphaFold Q8BQM8
Predicted Effect probably benign
Transcript: ENSMUST00000065716
AA Change: L821P

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: L821P

DomainStartEndE-ValueType
Pfam:HELP 1 49 3.3e-21 PFAM
WD40 50 91 6.42e-1 SMART
WD40 94 136 1.08e-4 SMART
WD40 139 178 1.27e-1 SMART
WD40 184 224 2.75e1 SMART
WD40 225 263 2.65e-4 SMART
Blast:WD40 265 312 2e-22 BLAST
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.2e2 SMART
WD40 397 436 8.59e-1 SMART
WD40 444 479 6.6e1 SMART
WD40 505 546 2.74e2 SMART
WD40 552 592 4.8e-2 SMART
low complexity region 609 632 N/A INTRINSIC
Pfam:HELP 656 715 1.4e-20 PFAM
WD40 716 757 1.18e-1 SMART
WD40 760 802 2.84e-4 SMART
WD40 805 844 1.91e1 SMART
WD40 853 891 2.64e2 SMART
WD40 892 929 3.45e-3 SMART
WD40 985 1026 4.55e-3 SMART
WD40 1029 1068 6.39e0 SMART
WD40 1071 1111 5.15e-2 SMART
WD40 1180 1221 1.9e2 SMART
WD40 1227 1267 1.38e0 SMART
low complexity region 1280 1297 N/A INTRINSIC
Pfam:HELP 1335 1410 2.4e-16 PFAM
Blast:WD40 1412 1462 8e-28 BLAST
WD40 1465 1507 1.56e-1 SMART
WD40 1510 1549 2.06e0 SMART
WD40 1558 1597 8.22e1 SMART
WD40 1599 1644 4.26e1 SMART
WD40 1690 1730 2.19e-5 SMART
WD40 1774 1813 5.97e-1 SMART
WD40 1884 1925 2.39e0 SMART
WD40 1931 1971 2.88e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000223282
AA Change: L860P

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik A G 8: 105,282,143 V414A probably damaging Het
Abcb10 T A 8: 123,982,608 Q69L probably benign Het
Abtb2 A C 2: 103,716,065 Q930P probably null Het
Adam18 G A 8: 24,668,558 T73I probably benign Het
Ankrd54 A T 15: 79,062,796 M1K probably null Het
Anks1 T C 17: 28,058,426 V1106A probably damaging Het
Aox2 A T 1: 58,312,356 I701F probably damaging Het
Arfgef3 C T 10: 18,589,639 R2152H probably damaging Het
Arnt2 C T 7: 84,361,590 G37E probably damaging Het
Arpp21 G A 9: 112,124,888 T581M probably benign Het
Arvcf A G 16: 18,398,207 N428S probably damaging Het
C2cd3 A G 7: 100,448,819 E1471G Het
Cadm1 A G 9: 47,799,432 K211R probably benign Het
Cdh6 A G 15: 13,064,376 S143P probably damaging Het
Cep152 G A 2: 125,579,436 Q1125* probably null Het
Cfap54 A C 10: 92,935,098 S2095A unknown Het
Col12a1 T C 9: 79,706,363 T67A probably benign Het
Col6a3 T C 1: 90,772,981 N3216S unknown Het
Cpeb2 T A 5: 43,234,112 L217Q Het
Ctbp2 A T 7: 132,995,292 N119K probably damaging Het
Des G T 1: 75,363,645 V399L probably benign Het
Dnah2 G T 11: 69,477,253 H1753Q probably damaging Het
Dnajc6 T C 4: 101,618,616 V562A probably benign Het
Dusp13 T C 14: 21,741,087 D99G probably benign Het
Ehd3 A G 17: 73,820,566 I165V probably benign Het
Eme2 C T 17: 24,893,079 V241M probably damaging Het
Eogt T A 6: 97,112,082 K521M possibly damaging Het
Epb41l5 T C 1: 119,578,971 T489A probably benign Het
Fmo5 G T 3: 97,651,486 V421L probably benign Het
Gabpa C T 16: 84,856,515 P268S probably benign Het
Gas2l3 G T 10: 89,426,453 H136N probably benign Het
Gm5592 C T 7: 41,288,983 A563V possibly damaging Het
Gpn3 A T 5: 122,381,445 D205V probably benign Het
H13 T C 2: 152,681,079 L104S probably damaging Het
H2-Q4 T A 17: 35,380,129 V125E probably benign Het
Ifih1 A G 2: 62,611,898 F374S probably damaging Het
Ildr2 A G 1: 166,303,589 D338G probably damaging Het
Kmt2b A T 7: 30,582,468 N1162K probably null Het
Lmntd1 T C 6: 145,413,530 D298G probably damaging Het
Lrrc32 T A 7: 98,499,138 V375E probably benign Het
Lrrc37a A C 11: 103,502,196 I801R probably benign Het
Mgam A G 6: 40,680,187 E935G probably benign Het
Mms22l A T 4: 24,588,238 T917S probably damaging Het
Myo3a A T 2: 22,577,533 E1204D possibly damaging Het
Nav3 T A 10: 109,714,382 E1829V probably damaging Het
Nccrp1 C T 7: 28,546,207 G150D probably damaging Het
Nlrp4b G T 7: 10,710,160 W12L probably damaging Het
Nmb T C 7: 80,904,253 T71A possibly damaging Het
Ogfod2 T A 5: 124,112,442 H35Q probably benign Het
Ola1 A T 2: 73,099,388 S290R probably damaging Het
Olfr1297 A T 2: 111,621,984 I30N possibly damaging Het
Olfr1499 A T 19: 13,814,735 L285* probably null Het
Olfr390 T G 11: 73,787,455 N172K probably benign Het
Olfr493 T G 7: 108,346,679 T101P probably benign Het
Olfr589 C A 7: 103,155,202 E182* probably null Het
Olfr621-ps1 T G 7: 103,629,336 Y208S unknown Het
Pcsk9 T C 4: 106,458,850 D132G possibly damaging Het
Pkhd1 A T 1: 20,373,950 V2296E probably damaging Het
Prl2c5 A T 13: 13,190,712 I151L probably damaging Het
Prl3d3 A T 13: 27,160,948 D101V possibly damaging Het
Prrt1 A G 17: 34,631,146 Y178C probably damaging Het
Rasal1 A T 5: 120,655,090 I87F possibly damaging Het
Rpgrip1l A T 8: 91,260,986 Y814* probably null Het
Rpl3l T G 17: 24,732,473 probably null Het
Rrbp1 C A 2: 144,011,241 probably benign Het
Ryr3 A G 2: 112,653,019 S4158P probably damaging Het
Scube2 G T 7: 109,799,308 S951Y probably damaging Het
Sec14l1 T C 11: 117,150,176 V396A probably benign Het
Sh3gl1 T A 17: 56,018,911 K173* probably null Het
Shank3 A T 15: 89,504,318 E371V probably damaging Het
Slc25a24 A G 3: 109,159,435 T302A probably damaging Het
Slc25a41 A T 17: 57,041,580 H4Q probably benign Het
Slc45a1 A T 4: 150,638,614 V271D possibly damaging Het
Smad6 A T 9: 64,020,291 L245Q probably damaging Het
Smad7 C A 18: 75,394,246 Q388K probably damaging Het
Snx29 G T 16: 11,714,935 D348Y possibly damaging Het
Son A T 16: 91,677,682 H2418L unknown Het
Sppl3 G A 5: 115,095,863 V331M probably damaging Het
St13 T G 15: 81,388,368 T92P probably benign Het
St3gal4 A G 9: 35,052,347 W222R probably damaging Het
Stk32a T A 18: 43,311,934 N264K probably benign Het
Stoml3 T A 3: 53,497,976 I26N possibly damaging Het
Taf7 T C 18: 37,642,968 E182G probably damaging Het
Tas2r138 A G 6: 40,613,195 V39A probably damaging Het
Tbc1d12 A G 19: 38,901,379 S418G possibly damaging Het
Tbr1 T A 2: 61,812,379 C663S probably benign Het
Tmc5 A T 7: 118,623,278 Y67F probably benign Het
Tnfsf4 A C 1: 161,417,243 I168L probably benign Het
Trav5-1 T G 14: 52,622,890 S51A probably benign Het
Trmt10c A T 16: 56,034,283 C330S possibly damaging Het
Trpm1 T C 7: 64,234,965 M798T probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Unc13d CATGCC CATGCCTCCGATGCC 11: 116,068,181 probably benign Het
Vmn1r199 A G 13: 22,382,652 T39A possibly damaging Het
Vmn1r74 T A 7: 11,847,072 C100S possibly damaging Het
Vmn2r77 T A 7: 86,803,094 I494K possibly damaging Het
Wdr17 G A 8: 54,659,619 Q816* probably null Het
Other mutations in Eml5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Eml5 APN 12 98873209 splice site probably benign
IGL00473:Eml5 APN 12 98805492 splice site probably benign
IGL01120:Eml5 APN 12 98844019 missense probably benign
IGL01308:Eml5 APN 12 98802313 missense probably damaging 1.00
IGL01790:Eml5 APN 12 98798932 missense probably damaging 1.00
IGL01973:Eml5 APN 12 98863280 missense probably benign
IGL02182:Eml5 APN 12 98802322 missense probably damaging 1.00
IGL02201:Eml5 APN 12 98794424 splice site probably benign
IGL02375:Eml5 APN 12 98844087 missense probably damaging 1.00
IGL02397:Eml5 APN 12 98790674 missense probably benign 0.07
IGL02480:Eml5 APN 12 98876243 missense probably damaging 1.00
IGL02801:Eml5 APN 12 98817845 missense possibly damaging 0.88
IGL02876:Eml5 APN 12 98858841 missense probably damaging 1.00
IGL03104:Eml5 APN 12 98861245 nonsense probably null
IGL03158:Eml5 APN 12 98827514 splice site probably benign
IGL03286:Eml5 APN 12 98860503 missense probably damaging 1.00
IGL03380:Eml5 APN 12 98874647 splice site probably benign
BB010:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
BB020:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
R0573:Eml5 UTSW 12 98824772 splice site probably null
R0624:Eml5 UTSW 12 98865479 missense probably damaging 1.00
R0993:Eml5 UTSW 12 98861183 missense probably benign 0.25
R1073:Eml5 UTSW 12 98830973 missense probably damaging 1.00
R1183:Eml5 UTSW 12 98792046 missense probably benign 0.31
R1352:Eml5 UTSW 12 98831003 splice site probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1503:Eml5 UTSW 12 98831174 missense probably damaging 0.99
R1538:Eml5 UTSW 12 98794276 missense probably damaging 0.99
R1689:Eml5 UTSW 12 98830935 missense probably damaging 1.00
R1773:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1775:Eml5 UTSW 12 98852704 splice site probably null
R1791:Eml5 UTSW 12 98887056 missense probably benign 0.31
R1856:Eml5 UTSW 12 98810584 missense probably damaging 1.00
R1919:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1957:Eml5 UTSW 12 98859961 missense probably damaging 1.00
R1962:Eml5 UTSW 12 98876311 missense probably damaging 0.99
R2033:Eml5 UTSW 12 98791386 missense possibly damaging 0.71
R2035:Eml5 UTSW 12 98794266 missense probably benign 0.33
R2073:Eml5 UTSW 12 98802446 missense probably damaging 0.99
R2143:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2144:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2158:Eml5 UTSW 12 98843946 splice site probably benign
R2164:Eml5 UTSW 12 98887097 missense probably damaging 0.99
R2175:Eml5 UTSW 12 98876223 nonsense probably null
R2200:Eml5 UTSW 12 98825417 missense probably damaging 1.00
R2234:Eml5 UTSW 12 98841581 missense probably damaging 1.00
R2504:Eml5 UTSW 12 98844105 missense possibly damaging 0.71
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2958:Eml5 UTSW 12 98876178 missense possibly damaging 0.74
R3013:Eml5 UTSW 12 98880808 splice site probably null
R3118:Eml5 UTSW 12 98865494 missense probably damaging 0.97
R3735:Eml5 UTSW 12 98855989 missense possibly damaging 0.78
R3856:Eml5 UTSW 12 98816024 missense probably damaging 1.00
R3900:Eml5 UTSW 12 98825523 missense probably damaging 1.00
R3973:Eml5 UTSW 12 98802465 splice site probably benign
R3976:Eml5 UTSW 12 98802465 splice site probably benign
R4105:Eml5 UTSW 12 98841548 splice site probably null
R4107:Eml5 UTSW 12 98841548 splice site probably null
R4108:Eml5 UTSW 12 98841548 splice site probably null
R4109:Eml5 UTSW 12 98841548 splice site probably null
R4258:Eml5 UTSW 12 98865434 missense probably benign 0.01
R4381:Eml5 UTSW 12 98815955 missense possibly damaging 0.93
R4590:Eml5 UTSW 12 98837341 missense possibly damaging 0.91
R4737:Eml5 UTSW 12 98798852 missense probably damaging 1.00
R4775:Eml5 UTSW 12 98802307 missense probably benign 0.05
R4850:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5007:Eml5 UTSW 12 98830965 missense probably damaging 1.00
R5092:Eml5 UTSW 12 98792616 missense probably damaging 1.00
R5123:Eml5 UTSW 12 98874512 missense probably damaging 1.00
R5124:Eml5 UTSW 12 98792042 missense probably damaging 1.00
R5273:Eml5 UTSW 12 98790688 missense probably damaging 1.00
R5369:Eml5 UTSW 12 98858783 missense probably damaging 1.00
R5430:Eml5 UTSW 12 98794158 missense probably damaging 1.00
R5748:Eml5 UTSW 12 98825555 missense probably damaging 0.99
R5769:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5832:Eml5 UTSW 12 98876188 missense probably benign
R6113:Eml5 UTSW 12 98824674 nonsense probably null
R6131:Eml5 UTSW 12 98861251 missense probably damaging 0.99
R6175:Eml5 UTSW 12 98794456 missense possibly damaging 0.69
R6184:Eml5 UTSW 12 98863129 missense possibly damaging 0.53
R6357:Eml5 UTSW 12 98870884 missense probably damaging 0.98
R6375:Eml5 UTSW 12 98798868
R6528:Eml5 UTSW 12 98824637 missense probably benign 0.18
R6657:Eml5 UTSW 12 98791405 missense probably damaging 0.98
R6717:Eml5 UTSW 12 98827506 missense probably damaging 1.00
R6751:Eml5 UTSW 12 98865400 missense probably damaging 1.00
R6833:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6834:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6972:Eml5 UTSW 12 98876180 missense probably benign 0.00
R7091:Eml5 UTSW 12 98802474 missense probably benign 0.16
R7353:Eml5 UTSW 12 98825424 missense
R7644:Eml5 UTSW 12 98855944 missense probably benign 0.05
R7694:Eml5 UTSW 12 98792563 missense probably damaging 0.99
R7842:Eml5 UTSW 12 98794135 missense probably damaging 1.00
R7933:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
R8111:Eml5 UTSW 12 98792514 critical splice donor site probably null
R8198:Eml5 UTSW 12 98858886 nonsense probably null
R8482:Eml5 UTSW 12 98876301 missense probably damaging 1.00
R8732:Eml5 UTSW 12 98815959 missense probably damaging 0.99
R8956:Eml5 UTSW 12 98852693 missense possibly damaging 0.69
R8975:Eml5 UTSW 12 98810570 missense probably damaging 0.99
R9131:Eml5 UTSW 12 98858840 missense probably damaging 1.00
R9261:Eml5 UTSW 12 98856028 missense probably damaging 0.99
R9276:Eml5 UTSW 12 98798801 missense probably damaging 0.99
R9301:Eml5 UTSW 12 98882033 nonsense probably null
R9368:Eml5 UTSW 12 98796578 missense probably benign 0.31
R9392:Eml5 UTSW 12 98900940 missense probably damaging 1.00
R9393:Eml5 UTSW 12 98876174 missense probably benign 0.35
R9449:Eml5 UTSW 12 98861295 missense probably damaging 1.00
T0722:Eml5 UTSW 12 98841582 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCCCTCCATGATAGCTG -3'
(R):5'- GTCAATGTGAGCCTGTATTGATC -3'

Sequencing Primer
(F):5'- ACATCTCTCCAGATGCAC -3'
(R):5'- TTCCCCAAGAAGATTGATAGATTTG -3'
Posted On 2022-03-25