Incidental Mutation 'R9258:Sh3gl1'
ID 702070
Institutional Source Beutler Lab
Gene Symbol Sh3gl1
Ensembl Gene ENSMUSG00000003200
Gene Name SH3-domain GRB2-like 1
Synonyms endophilin A2, EEN, endophilin II, Sh3d2b, SH3P8
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9258 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 56323750-56343635 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 56325911 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 173 (K173*)
Ref Sequence ENSEMBL: ENSMUSP00000003268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003268] [ENSMUST00000149441] [ENSMUST00000159996] [ENSMUST00000162883]
AlphaFold Q62419
Predicted Effect probably null
Transcript: ENSMUST00000003268
AA Change: K173*
SMART Domains Protein: ENSMUSP00000003268
Gene: ENSMUSG00000003200
AA Change: K173*

DomainStartEndE-ValueType
BAR 5 242 1.05e-98 SMART
low complexity region 250 264 N/A INTRINSIC
SH3 309 364 7.62e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149441
SMART Domains Protein: ENSMUSP00000119745
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 32 71 N/A INTRINSIC
low complexity region 172 185 N/A INTRINSIC
JAB_MPN 260 382 1.35e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153197
SMART Domains Protein: ENSMUSP00000125535
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Pfam:JAB 112 243 6.1e-11 PFAM
Pfam:Prok-JAB 125 258 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159340
SMART Domains Protein: ENSMUSP00000125555
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
low complexity region 29 68 N/A INTRINSIC
low complexity region 169 182 N/A INTRINSIC
Blast:JAB_MPN 257 350 3e-55 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159996
SMART Domains Protein: ENSMUSP00000124644
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 32 71 N/A INTRINSIC
low complexity region 172 185 N/A INTRINSIC
JAB_MPN 260 382 1.35e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162883
SMART Domains Protein: ENSMUSP00000124128
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 32 71 N/A INTRINSIC
low complexity region 172 185 N/A INTRINSIC
Pfam:Prok-JAB 230 340 1.6e-8 PFAM
Pfam:JAB 236 311 1.7e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the endophilin family of Src homology 3 domain-containing proteins. The encoded protein is involved in endocytosis and may also play a role in the cell cycle. Overexpression of this gene may play a role in leukemogenesis, and the encoded protein has been implicated in acute myeloid leukemia as a fusion partner of the myeloid-lymphoid leukemia protein. Pseudogenes of this gene are located on the long arm of chromosomes 11 and 17. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal life span and no obvious phenotypic defects. Mice homozygous for knock-out alleles of Sh3gl1-3 exhibit neonatal lethality, respiratory distress, absence of gastric milk, abnormal synaptic transmissionand abnormal synaptic vesicle recycling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 T A 8: 124,709,347 (GRCm39) Q69L probably benign Het
Abtb2 A C 2: 103,546,410 (GRCm39) Q930P probably null Het
Adam18 G A 8: 25,158,574 (GRCm39) T73I probably benign Het
Ankrd54 A T 15: 78,946,996 (GRCm39) M1K probably null Het
Anks1 T C 17: 28,277,400 (GRCm39) V1106A probably damaging Het
Aox1 A T 1: 58,351,515 (GRCm39) I701F probably damaging Het
Arfgef3 C T 10: 18,465,387 (GRCm39) R2152H probably damaging Het
Arnt2 C T 7: 84,010,798 (GRCm39) G37E probably damaging Het
Arpp21 G A 9: 111,953,956 (GRCm39) T581M probably benign Het
Arvcf A G 16: 18,216,957 (GRCm39) N428S probably damaging Het
C2cd3 A G 7: 100,098,026 (GRCm39) E1471G Het
Cadm1 A G 9: 47,710,730 (GRCm39) K211R probably benign Het
Cdh6 A G 15: 13,064,462 (GRCm39) S143P probably damaging Het
Cep152 G A 2: 125,421,356 (GRCm39) Q1125* probably null Het
Cfap54 A C 10: 92,770,960 (GRCm39) S2095A unknown Het
Col12a1 T C 9: 79,613,645 (GRCm39) T67A probably benign Het
Col6a3 T C 1: 90,700,703 (GRCm39) N3216S unknown Het
Cpeb2 T A 5: 43,391,455 (GRCm39) L217Q Het
Ctbp2 A T 7: 132,597,021 (GRCm39) N119K probably damaging Het
Des G T 1: 75,340,289 (GRCm39) V399L probably benign Het
Dnah2 G T 11: 69,368,079 (GRCm39) H1753Q probably damaging Het
Dnajc6 T C 4: 101,475,813 (GRCm39) V562A probably benign Het
Dusp13b T C 14: 21,791,155 (GRCm39) D99G probably benign Het
Ehd3 A G 17: 74,127,561 (GRCm39) I165V probably benign Het
Eme2 C T 17: 25,112,053 (GRCm39) V241M probably damaging Het
Eml5 A G 12: 98,810,376 (GRCm39) L860P possibly damaging Het
Eogt T A 6: 97,089,043 (GRCm39) K521M possibly damaging Het
Epb41l5 T C 1: 119,506,701 (GRCm39) T489A probably benign Het
Fmo5 G T 3: 97,558,802 (GRCm39) V421L probably benign Het
Gabpa C T 16: 84,653,403 (GRCm39) P268S probably benign Het
Gas2l3 G T 10: 89,262,315 (GRCm39) H136N probably benign Het
Gm5592 C T 7: 40,938,407 (GRCm39) A563V possibly damaging Het
Gpn3 A T 5: 122,519,508 (GRCm39) D205V probably benign Het
H13 T C 2: 152,522,999 (GRCm39) L104S probably damaging Het
H2-Q4 T A 17: 35,599,105 (GRCm39) V125E probably benign Het
Ifih1 A G 2: 62,442,242 (GRCm39) F374S probably damaging Het
Ildr2 A G 1: 166,131,158 (GRCm39) D338G probably damaging Het
Kmt2b A T 7: 30,281,893 (GRCm39) N1162K probably null Het
Lmntd1 T C 6: 145,359,256 (GRCm39) D298G probably damaging Het
Lrrc32 T A 7: 98,148,345 (GRCm39) V375E probably benign Het
Lrrc37a A C 11: 103,393,022 (GRCm39) I801R probably benign Het
Matcap1 A G 8: 106,008,775 (GRCm39) V414A probably damaging Het
Mgam A G 6: 40,657,121 (GRCm39) E935G probably benign Het
Mms22l A T 4: 24,588,238 (GRCm39) T917S probably damaging Het
Myo3a A T 2: 22,467,545 (GRCm39) E1204D possibly damaging Het
Nav3 T A 10: 109,550,243 (GRCm39) E1829V probably damaging Het
Nccrp1 C T 7: 28,245,632 (GRCm39) G150D probably damaging Het
Nlrp4b G T 7: 10,444,087 (GRCm39) W12L probably damaging Het
Nmb T C 7: 80,554,001 (GRCm39) T71A possibly damaging Het
Ogfod2 T A 5: 124,250,505 (GRCm39) H35Q probably benign Het
Ola1 A T 2: 72,929,732 (GRCm39) S290R probably damaging Het
Or1e30 T G 11: 73,678,281 (GRCm39) N172K probably benign Het
Or4k47 A T 2: 111,452,329 (GRCm39) I30N possibly damaging Het
Or51v15-ps1 T G 7: 103,278,543 (GRCm39) Y208S unknown Het
Or52e2 C A 7: 102,804,409 (GRCm39) E182* probably null Het
Or5p68 T G 7: 107,945,886 (GRCm39) T101P probably benign Het
Or9i14 A T 19: 13,792,099 (GRCm39) L285* probably null Het
Pcsk9 T C 4: 106,316,047 (GRCm39) D132G possibly damaging Het
Pkhd1 A T 1: 20,444,174 (GRCm39) V2296E probably damaging Het
Prl2c5 A T 13: 13,365,297 (GRCm39) I151L probably damaging Het
Prl3d3 A T 13: 27,344,931 (GRCm39) D101V possibly damaging Het
Prrt1 A G 17: 34,850,120 (GRCm39) Y178C probably damaging Het
Rasal1 A T 5: 120,793,155 (GRCm39) I87F possibly damaging Het
Rpgrip1l A T 8: 91,987,614 (GRCm39) Y814* probably null Het
Rpl3l T G 17: 24,951,447 (GRCm39) probably null Het
Rrbp1 C A 2: 143,853,161 (GRCm39) probably benign Het
Ryr3 A G 2: 112,483,364 (GRCm39) S4158P probably damaging Het
Scube2 G T 7: 109,398,515 (GRCm39) S951Y probably damaging Het
Sec14l1 T C 11: 117,041,002 (GRCm39) V396A probably benign Het
Shank3 A T 15: 89,388,521 (GRCm39) E371V probably damaging Het
Slc25a24 A G 3: 109,066,751 (GRCm39) T302A probably damaging Het
Slc25a41 A T 17: 57,348,580 (GRCm39) H4Q probably benign Het
Slc45a1 A T 4: 150,723,071 (GRCm39) V271D possibly damaging Het
Smad6 A T 9: 63,927,573 (GRCm39) L245Q probably damaging Het
Smad7 C A 18: 75,527,317 (GRCm39) Q388K probably damaging Het
Snx29 G T 16: 11,532,799 (GRCm39) D348Y possibly damaging Het
Son A T 16: 91,474,570 (GRCm39) H2418L unknown Het
Sppl3 G A 5: 115,233,922 (GRCm39) V331M probably damaging Het
St13 T G 15: 81,272,569 (GRCm39) T92P probably benign Het
St3gal4 A G 9: 34,963,643 (GRCm39) W222R probably damaging Het
Stk32a T A 18: 43,444,999 (GRCm39) N264K probably benign Het
Stoml3 T A 3: 53,405,397 (GRCm39) I26N possibly damaging Het
Taf7 T C 18: 37,776,021 (GRCm39) E182G probably damaging Het
Tas2r138 A G 6: 40,590,129 (GRCm39) V39A probably damaging Het
Tbc1d12 A G 19: 38,889,823 (GRCm39) S418G possibly damaging Het
Tbr1 T A 2: 61,642,723 (GRCm39) C663S probably benign Het
Tmc5 A T 7: 118,222,501 (GRCm39) Y67F probably benign Het
Tnfsf4 A C 1: 161,244,814 (GRCm39) I168L probably benign Het
Trav5-1 T G 14: 52,860,347 (GRCm39) S51A probably benign Het
Trmt10c A T 16: 55,854,646 (GRCm39) C330S possibly damaging Het
Trpm1 T C 7: 63,884,713 (GRCm39) M798T probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 115,958,998 (GRCm39) probably benign Het
Unc13d CATGCC CATGCCTCCGATGCC 11: 115,959,007 (GRCm39) probably benign Het
Vmn1r199 A G 13: 22,566,822 (GRCm39) T39A possibly damaging Het
Vmn1r74 T A 7: 11,580,999 (GRCm39) C100S possibly damaging Het
Vmn2r77 T A 7: 86,452,302 (GRCm39) I494K possibly damaging Het
Wdr17 G A 8: 55,112,654 (GRCm39) Q816* probably null Het
Other mutations in Sh3gl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Sh3gl1 APN 17 56,326,325 (GRCm39) missense possibly damaging 0.48
IGL02721:Sh3gl1 APN 17 56,324,577 (GRCm39) missense possibly damaging 0.91
feroce UTSW 17 56,324,617 (GRCm39) missense possibly damaging 0.84
sauvage UTSW 17 56,326,038 (GRCm39) critical splice donor site probably null
R0092:Sh3gl1 UTSW 17 56,325,088 (GRCm39) missense probably benign 0.00
R0525:Sh3gl1 UTSW 17 56,324,873 (GRCm39) missense probably benign 0.00
R3684:Sh3gl1 UTSW 17 56,325,953 (GRCm39) missense possibly damaging 0.91
R3792:Sh3gl1 UTSW 17 56,325,949 (GRCm39) missense probably damaging 1.00
R4282:Sh3gl1 UTSW 17 56,343,456 (GRCm39) missense probably damaging 1.00
R4298:Sh3gl1 UTSW 17 56,326,173 (GRCm39) missense probably damaging 1.00
R5868:Sh3gl1 UTSW 17 56,326,119 (GRCm39) missense probably damaging 1.00
R6304:Sh3gl1 UTSW 17 56,343,431 (GRCm39) missense probably benign 0.01
R6379:Sh3gl1 UTSW 17 56,326,143 (GRCm39) missense probably damaging 1.00
R6523:Sh3gl1 UTSW 17 56,324,617 (GRCm39) missense possibly damaging 0.84
R7146:Sh3gl1 UTSW 17 56,324,646 (GRCm39) missense probably damaging 1.00
R7174:Sh3gl1 UTSW 17 56,324,846 (GRCm39) missense probably benign 0.01
R7922:Sh3gl1 UTSW 17 56,326,438 (GRCm39) missense probably damaging 1.00
R8248:Sh3gl1 UTSW 17 56,326,038 (GRCm39) critical splice donor site probably null
R8429:Sh3gl1 UTSW 17 56,325,821 (GRCm39) missense possibly damaging 0.94
R8460:Sh3gl1 UTSW 17 56,326,321 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TCATCCTGGAGCTTCAACAAAC -3'
(R):5'- ACTCACTGGACATCGAGGTC -3'

Sequencing Primer
(F):5'- ACCCCTTCTCAGTAGGCAG -3'
(R):5'- CATCGAGGTCAAGCAGAACTTCATTG -3'
Posted On 2022-03-25