Incidental Mutation 'R9259:Iqgap2'
ID 702124
Institutional Source Beutler Lab
Gene Symbol Iqgap2
Ensembl Gene ENSMUSG00000021676
Gene Name IQ motif containing GTPase activating protein 2
Synonyms 4933417J23Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9259 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 95763685-96028788 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 95766561 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 1481 (Y1481N)
Ref Sequence ENSEMBL: ENSMUSP00000067685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068603]
AlphaFold Q3UQ44
Predicted Effect probably damaging
Transcript: ENSMUST00000068603
AA Change: Y1481N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676
AA Change: Y1481N

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains three IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display reduced survival with increased incidence of hepatocellular carcinomas, increased hepatocyte apoptosis, and hepatocyte mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot6 A G 12: 84,155,816 (GRCm39) I255V possibly damaging Het
Adcy8 A T 15: 64,576,604 (GRCm39) I986N probably damaging Het
Agr2 T A 12: 36,053,863 (GRCm39) M164K probably damaging Het
Akap11 G A 14: 78,749,949 (GRCm39) H813Y Het
Alas1 A T 9: 106,118,835 (GRCm39) S195T probably benign Het
Aldoart1 T C 4: 72,770,680 (GRCm39) T43A probably benign Het
Alms1 A G 6: 85,644,873 (GRCm39) D2537G possibly damaging Het
Alpk3 A G 7: 80,743,302 (GRCm39) T1040A probably damaging Het
Ankrd16 T C 2: 11,784,532 (GRCm39) I120T probably damaging Het
Anks4b A G 7: 119,773,278 (GRCm39) E46G probably benign Het
Ap3d1 A T 10: 80,559,661 (GRCm39) V199E probably damaging Het
Atp1a3 A G 7: 24,696,956 (GRCm39) S236P probably damaging Het
Atp5mc2 T A 15: 102,571,561 (GRCm39) N110I probably damaging Het
Cabin1 A G 10: 75,582,576 (GRCm39) M280T probably benign Het
Cdc5l T C 17: 45,736,817 (GRCm39) T134A possibly damaging Het
Clec4n C A 6: 123,212,424 (GRCm39) P80Q probably damaging Het
Clip3 A G 7: 29,998,375 (GRCm39) K274E probably benign Het
Cntrob A T 11: 69,211,665 (GRCm39) D186E possibly damaging Het
Cplane1 T C 15: 8,232,787 (GRCm39) V1102A possibly damaging Het
Dcun1d3 A G 7: 119,457,052 (GRCm39) V220A probably benign Het
Emsy A T 7: 98,242,757 (GRCm39) N1127K probably benign Het
Entpd2 C T 2: 25,288,614 (GRCm39) S206L probably damaging Het
Fgd4 T C 16: 16,295,325 (GRCm39) E218G probably damaging Het
Fkbp2 G T 19: 6,955,960 (GRCm39) Q82K probably benign Het
Gpr161 T C 1: 165,138,025 (GRCm39) Y204H probably damaging Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
Gstt2 C T 10: 75,669,511 (GRCm39) D59N possibly damaging Het
Havcr1 A T 11: 46,661,318 (GRCm39) D206V probably damaging Het
Hoxb9 G A 11: 96,162,762 (GRCm39) G132D probably damaging Het
Ifi44 C T 3: 151,454,875 (GRCm39) V117M possibly damaging Het
Inhbe A G 10: 127,186,844 (GRCm39) F112S probably damaging Het
Irak4 A T 15: 94,456,726 (GRCm39) H303L probably damaging Het
Kdm5d A G Y: 942,640 (GRCm39) E1435G possibly damaging Het
Kifc1 G T 17: 34,101,165 (GRCm39) T599K possibly damaging Het
Klhl38 T C 15: 58,186,471 (GRCm39) E86G probably benign Het
Mcub G C 3: 129,720,070 (GRCm39) T141R probably benign Het
Moxd2 A T 6: 40,860,969 (GRCm39) V274D probably damaging Het
Nol6 C T 4: 41,118,229 (GRCm39) V803M possibly damaging Het
Or8b51 C T 9: 38,569,642 (GRCm39) probably benign Het
Ovgp1 T C 3: 105,893,883 (GRCm39) probably benign Het
Pbld1 A G 10: 62,897,436 (GRCm39) T46A possibly damaging Het
Peli3 T C 19: 4,984,486 (GRCm39) D192G probably benign Het
Perm1 C T 4: 156,303,607 (GRCm39) T717I probably benign Het
Pim1 G A 17: 29,710,181 (GRCm39) A22T probably benign Het
Pkp2 C T 16: 16,043,714 (GRCm39) P156L probably damaging Het
Ppwd1 G A 13: 104,359,612 (GRCm39) R130C probably damaging Het
Prdm16 C A 4: 154,430,525 (GRCm39) W321L possibly damaging Het
Ptprd T A 4: 75,990,200 (GRCm39) D504V probably damaging Het
Pusl1 T C 4: 155,975,639 (GRCm39) T65A probably damaging Het
Rtcb A G 10: 85,774,925 (GRCm39) I490T probably damaging Het
Sec31b G T 19: 44,505,855 (GRCm39) L967I probably damaging Het
Sec63 A C 10: 42,699,937 (GRCm39) M666L probably benign Het
Sh3rf1 G C 8: 61,806,838 (GRCm39) A379P probably benign Het
Slc7a12 T A 3: 14,546,376 (GRCm39) L174I probably damaging Het
Sptbn4 C T 7: 27,067,124 (GRCm39) S1935N possibly damaging Het
Susd6 A T 12: 80,898,030 (GRCm39) Q55L probably benign Het
Tecpr2 A G 12: 110,897,867 (GRCm39) E373G possibly damaging Het
Tent5c T C 3: 100,379,640 (GRCm39) Y372C probably damaging Het
Tm6sf2 A T 8: 70,530,585 (GRCm39) I222L probably benign Het
Tsc22d1 T A 14: 76,654,484 (GRCm39) V321E probably damaging Het
Tspoap1 A G 11: 87,670,350 (GRCm39) N172S Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 115,958,998 (GRCm39) probably benign Het
Vcan G A 13: 89,838,989 (GRCm39) S2185F probably damaging Het
Wapl G T 14: 34,463,052 (GRCm39) V1131L probably benign Het
Zfp658 A G 7: 43,224,280 (GRCm39) M852V probably benign Het
Other mutations in Iqgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Iqgap2 APN 13 95,794,452 (GRCm39) splice site probably benign
IGL01968:Iqgap2 APN 13 95,772,090 (GRCm39) missense possibly damaging 0.80
IGL02049:Iqgap2 APN 13 95,811,913 (GRCm39) splice site probably benign
IGL02195:Iqgap2 APN 13 95,798,242 (GRCm39) splice site probably benign
IGL02387:Iqgap2 APN 13 95,826,209 (GRCm39) missense probably benign 0.00
IGL02634:Iqgap2 APN 13 95,764,622 (GRCm39) missense probably damaging 1.00
IGL02666:Iqgap2 APN 13 95,764,564 (GRCm39) missense probably damaging 1.00
IGL02685:Iqgap2 APN 13 95,807,912 (GRCm39) missense probably damaging 1.00
IGL02927:Iqgap2 APN 13 95,861,184 (GRCm39) missense possibly damaging 0.62
IGL02943:Iqgap2 APN 13 95,798,243 (GRCm39) splice site probably benign
IGL03167:Iqgap2 APN 13 95,821,406 (GRCm39) missense probably benign 0.34
IGL03169:Iqgap2 APN 13 95,867,785 (GRCm39) splice site probably null
IGL03293:Iqgap2 APN 13 95,867,942 (GRCm39) missense probably damaging 1.00
G1Funyon:Iqgap2 UTSW 13 95,818,659 (GRCm39) critical splice donor site probably null
R0257:Iqgap2 UTSW 13 95,861,052 (GRCm39) critical splice donor site probably null
R0335:Iqgap2 UTSW 13 95,772,141 (GRCm39) missense probably damaging 0.99
R0360:Iqgap2 UTSW 13 95,867,783 (GRCm39) splice site probably benign
R0364:Iqgap2 UTSW 13 95,867,783 (GRCm39) splice site probably benign
R0419:Iqgap2 UTSW 13 95,826,207 (GRCm39) critical splice donor site probably null
R1229:Iqgap2 UTSW 13 95,768,673 (GRCm39) missense probably benign 0.32
R1290:Iqgap2 UTSW 13 95,805,021 (GRCm39) missense probably damaging 1.00
R1397:Iqgap2 UTSW 13 95,768,673 (GRCm39) missense probably benign 0.32
R1498:Iqgap2 UTSW 13 95,783,313 (GRCm39) missense probably benign
R1513:Iqgap2 UTSW 13 95,766,518 (GRCm39) missense probably damaging 1.00
R1630:Iqgap2 UTSW 13 95,826,293 (GRCm39) missense probably benign
R2088:Iqgap2 UTSW 13 96,028,171 (GRCm39) critical splice donor site probably null
R2928:Iqgap2 UTSW 13 95,818,744 (GRCm39) missense probably benign
R3026:Iqgap2 UTSW 13 95,809,564 (GRCm39) critical splice acceptor site probably null
R3720:Iqgap2 UTSW 13 95,805,036 (GRCm39) splice site probably null
R3846:Iqgap2 UTSW 13 95,810,186 (GRCm39) splice site probably benign
R4056:Iqgap2 UTSW 13 95,886,541 (GRCm39) missense probably damaging 1.00
R4077:Iqgap2 UTSW 13 95,794,375 (GRCm39) missense probably damaging 1.00
R4353:Iqgap2 UTSW 13 95,807,904 (GRCm39) missense probably damaging 1.00
R4517:Iqgap2 UTSW 13 95,800,569 (GRCm39) critical splice donor site probably null
R4628:Iqgap2 UTSW 13 95,899,837 (GRCm39) missense probably benign 0.17
R4686:Iqgap2 UTSW 13 95,858,117 (GRCm39) missense probably damaging 0.98
R4724:Iqgap2 UTSW 13 95,772,005 (GRCm39) missense possibly damaging 0.73
R4826:Iqgap2 UTSW 13 95,899,783 (GRCm39) missense probably damaging 1.00
R4847:Iqgap2 UTSW 13 95,810,251 (GRCm39) missense probably benign 0.19
R4967:Iqgap2 UTSW 13 95,766,514 (GRCm39) missense probably benign 0.00
R4973:Iqgap2 UTSW 13 95,794,305 (GRCm39) splice site probably null
R5010:Iqgap2 UTSW 13 95,810,251 (GRCm39) missense probably benign 0.19
R5086:Iqgap2 UTSW 13 95,772,088 (GRCm39) missense probably benign 0.01
R5496:Iqgap2 UTSW 13 95,766,561 (GRCm39) missense probably damaging 1.00
R5512:Iqgap2 UTSW 13 95,811,884 (GRCm39) nonsense probably null
R5629:Iqgap2 UTSW 13 95,768,682 (GRCm39) missense probably damaging 1.00
R5824:Iqgap2 UTSW 13 95,811,880 (GRCm39) missense probably damaging 0.99
R5830:Iqgap2 UTSW 13 95,811,880 (GRCm39) missense probably damaging 0.99
R5831:Iqgap2 UTSW 13 95,811,880 (GRCm39) missense probably damaging 0.99
R5832:Iqgap2 UTSW 13 95,811,880 (GRCm39) missense probably damaging 0.99
R5833:Iqgap2 UTSW 13 95,811,880 (GRCm39) missense probably damaging 0.99
R5834:Iqgap2 UTSW 13 95,811,880 (GRCm39) missense probably damaging 0.99
R5852:Iqgap2 UTSW 13 95,811,880 (GRCm39) missense probably damaging 0.99
R5888:Iqgap2 UTSW 13 95,772,118 (GRCm39) missense possibly damaging 0.89
R5889:Iqgap2 UTSW 13 95,768,550 (GRCm39) missense probably benign 0.00
R6093:Iqgap2 UTSW 13 95,765,471 (GRCm39) missense probably damaging 0.99
R6141:Iqgap2 UTSW 13 95,858,194 (GRCm39) splice site probably null
R6404:Iqgap2 UTSW 13 95,865,985 (GRCm39) missense probably benign 0.28
R6434:Iqgap2 UTSW 13 95,819,441 (GRCm39) missense possibly damaging 0.85
R6648:Iqgap2 UTSW 13 95,818,719 (GRCm39) missense probably benign 0.27
R6658:Iqgap2 UTSW 13 95,796,840 (GRCm39) missense probably damaging 1.00
R6903:Iqgap2 UTSW 13 95,797,565 (GRCm39) missense probably damaging 1.00
R7223:Iqgap2 UTSW 13 95,765,480 (GRCm39) missense probably damaging 1.00
R7327:Iqgap2 UTSW 13 95,772,163 (GRCm39) missense probably benign 0.00
R7371:Iqgap2 UTSW 13 95,836,846 (GRCm39) splice site probably null
R7378:Iqgap2 UTSW 13 95,869,398 (GRCm39) critical splice donor site probably null
R7441:Iqgap2 UTSW 13 95,764,584 (GRCm39) missense probably benign 0.23
R7575:Iqgap2 UTSW 13 95,798,131 (GRCm39) missense probably damaging 0.99
R7671:Iqgap2 UTSW 13 95,764,627 (GRCm39) missense probably damaging 0.98
R7713:Iqgap2 UTSW 13 95,867,952 (GRCm39) missense probably benign 0.01
R7806:Iqgap2 UTSW 13 95,818,765 (GRCm39) missense probably benign 0.00
R7893:Iqgap2 UTSW 13 95,826,217 (GRCm39) missense probably damaging 0.96
R8052:Iqgap2 UTSW 13 95,794,387 (GRCm39) missense probably damaging 0.96
R8121:Iqgap2 UTSW 13 95,861,076 (GRCm39) missense probably benign 0.00
R8261:Iqgap2 UTSW 13 95,772,078 (GRCm39) missense probably damaging 1.00
R8301:Iqgap2 UTSW 13 95,818,659 (GRCm39) critical splice donor site probably null
R8369:Iqgap2 UTSW 13 95,798,111 (GRCm39) missense probably damaging 1.00
R8485:Iqgap2 UTSW 13 95,796,659 (GRCm39) missense probably damaging 0.99
R8709:Iqgap2 UTSW 13 95,796,713 (GRCm39) missense probably damaging 0.99
R8710:Iqgap2 UTSW 13 95,796,756 (GRCm39) missense probably benign 0.24
R8737:Iqgap2 UTSW 13 95,802,258 (GRCm39) missense probably damaging 1.00
R8845:Iqgap2 UTSW 13 95,794,392 (GRCm39) missense possibly damaging 0.60
R8902:Iqgap2 UTSW 13 95,818,711 (GRCm39) missense probably benign 0.16
R8957:Iqgap2 UTSW 13 95,772,154 (GRCm39) missense probably damaging 1.00
R9153:Iqgap2 UTSW 13 95,844,547 (GRCm39) missense probably benign
R9290:Iqgap2 UTSW 13 95,886,523 (GRCm39) missense probably damaging 1.00
R9414:Iqgap2 UTSW 13 95,783,349 (GRCm39) missense
R9432:Iqgap2 UTSW 13 95,774,261 (GRCm39) missense probably benign
R9747:Iqgap2 UTSW 13 95,821,505 (GRCm39) missense probably damaging 1.00
X0066:Iqgap2 UTSW 13 95,807,891 (GRCm39) missense probably damaging 0.98
Z1176:Iqgap2 UTSW 13 95,867,951 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACCAGTGATCCGTAATCTAGGC -3'
(R):5'- CGATTGTCACCTTCTATTGCAG -3'

Sequencing Primer
(F):5'- GTGATCCGTAATCTAGGCTAAGCC -3'
(R):5'- GATTGTCACCTTCTATTGCAGATCAG -3'
Posted On 2022-03-25