Incidental Mutation 'R9259:Iqgap2'
ID 702124
Institutional Source Beutler Lab
Gene Symbol Iqgap2
Ensembl Gene ENSMUSG00000021676
Gene Name IQ motif containing GTPase activating protein 2
Synonyms 4933417J23Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9259 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 95627177-95891922 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 95630053 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 1481 (Y1481N)
Ref Sequence ENSEMBL: ENSMUSP00000067685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068603]
AlphaFold Q3UQ44
Predicted Effect probably damaging
Transcript: ENSMUST00000068603
AA Change: Y1481N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676
AA Change: Y1481N

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains three IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display reduced survival with increased incidence of hepatocellular carcinomas, increased hepatocyte apoptosis, and hepatocyte mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,203,303 V1102A possibly damaging Het
Acot6 A G 12: 84,109,042 I255V possibly damaging Het
Adcy8 A T 15: 64,704,755 I986N probably damaging Het
Agr2 T A 12: 36,003,864 M164K probably damaging Het
Akap11 G A 14: 78,512,509 H813Y Het
Alas1 A T 9: 106,241,636 S195T probably benign Het
Aldoart1 T C 4: 72,852,443 T43A probably benign Het
Alms1 A G 6: 85,667,891 D2537G possibly damaging Het
Alpk3 A G 7: 81,093,554 T1040A probably damaging Het
Ankrd16 T C 2: 11,779,721 I120T probably damaging Het
Anks4b A G 7: 120,174,055 E46G probably benign Het
Ap3d1 A T 10: 80,723,827 V199E probably damaging Het
Atp1a3 A G 7: 24,997,531 S236P probably damaging Het
Atp5g2 T A 15: 102,663,126 N110I probably damaging Het
Cabin1 A G 10: 75,746,742 M280T probably benign Het
Cdc5l T C 17: 45,425,891 T134A possibly damaging Het
Clec4n C A 6: 123,235,465 P80Q probably damaging Het
Clip3 A G 7: 30,298,950 K274E probably benign Het
Cntrob A T 11: 69,320,839 D186E possibly damaging Het
Dcun1d3 A G 7: 119,857,829 V220A probably benign Het
Emsy A T 7: 98,593,550 N1127K probably benign Het
Entpd2 C T 2: 25,398,602 S206L probably damaging Het
Fam46c T C 3: 100,472,324 Y372C probably damaging Het
Fgd4 T C 16: 16,477,461 E218G probably damaging Het
Fkbp2 G T 19: 6,978,592 Q82K probably benign Het
Gpr161 T C 1: 165,310,456 Y204H probably damaging Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Gstt2 C T 10: 75,833,677 D59N possibly damaging Het
Havcr1 A T 11: 46,770,491 D206V probably damaging Het
Hoxb9 G A 11: 96,271,936 G132D probably damaging Het
Ifi44 C T 3: 151,749,238 V117M possibly damaging Het
Inhbe A G 10: 127,350,975 F112S probably damaging Het
Irak4 A T 15: 94,558,845 H303L probably damaging Het
Kdm5d A G Y: 942,640 E1435G possibly damaging Het
Kifc1 G T 17: 33,882,191 T599K possibly damaging Het
Klhl38 T C 15: 58,323,075 E86G probably benign Het
Mcub G C 3: 129,926,421 T141R probably benign Het
Moxd2 A T 6: 40,884,035 V274D probably damaging Het
Nol6 C T 4: 41,118,229 V803M possibly damaging Het
Olfr916 C T 9: 38,658,346 probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Pbld1 A G 10: 63,061,657 T46A possibly damaging Het
Peli3 T C 19: 4,934,458 D192G probably benign Het
Perm1 C T 4: 156,219,150 T717I probably benign Het
Pim1 G A 17: 29,491,207 A22T probably benign Het
Pkp2 C T 16: 16,225,850 P156L probably damaging Het
Ppwd1 G A 13: 104,223,104 R130C probably damaging Het
Prdm16 C A 4: 154,346,068 W321L possibly damaging Het
Ptprd T A 4: 76,071,963 D504V probably damaging Het
Pusl1 T C 4: 155,891,182 T65A probably damaging Het
Rtcb A G 10: 85,939,061 I490T probably damaging Het
Sec31b G T 19: 44,517,416 L967I probably damaging Het
Sec63 A C 10: 42,823,941 M666L probably benign Het
Sh3rf1 G C 8: 61,353,804 A379P probably benign Het
Slc7a12 T A 3: 14,481,316 L174I probably damaging Het
Sptbn4 C T 7: 27,367,699 S1935N possibly damaging Het
Susd6 A T 12: 80,851,256 Q55L probably benign Het
Tecpr2 A G 12: 110,931,433 E373G possibly damaging Het
Tm6sf2 A T 8: 70,077,935 I222L probably benign Het
Tsc22d1 T A 14: 76,417,044 V321E probably damaging Het
Tspoap1 A G 11: 87,779,524 N172S Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Vcan G A 13: 89,690,870 S2185F probably damaging Het
Wapl G T 14: 34,741,095 V1131L probably benign Het
Zfp658 A G 7: 43,574,856 M852V probably benign Het
Other mutations in Iqgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Iqgap2 APN 13 95657944 splice site probably benign
IGL01968:Iqgap2 APN 13 95635582 missense possibly damaging 0.80
IGL02049:Iqgap2 APN 13 95675405 splice site probably benign
IGL02195:Iqgap2 APN 13 95661734 splice site probably benign
IGL02387:Iqgap2 APN 13 95689701 missense probably benign 0.00
IGL02634:Iqgap2 APN 13 95628114 missense probably damaging 1.00
IGL02666:Iqgap2 APN 13 95628056 missense probably damaging 1.00
IGL02685:Iqgap2 APN 13 95671404 missense probably damaging 1.00
IGL02927:Iqgap2 APN 13 95724676 missense possibly damaging 0.62
IGL02943:Iqgap2 APN 13 95661735 splice site probably benign
IGL03167:Iqgap2 APN 13 95684898 missense probably benign 0.34
IGL03169:Iqgap2 APN 13 95731277 splice site probably null
IGL03293:Iqgap2 APN 13 95731434 missense probably damaging 1.00
G1Funyon:Iqgap2 UTSW 13 95682151 critical splice donor site probably null
R0257:Iqgap2 UTSW 13 95724544 critical splice donor site probably null
R0335:Iqgap2 UTSW 13 95635633 missense probably damaging 0.99
R0360:Iqgap2 UTSW 13 95731275 splice site probably benign
R0364:Iqgap2 UTSW 13 95731275 splice site probably benign
R0419:Iqgap2 UTSW 13 95689699 critical splice donor site probably null
R1229:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1290:Iqgap2 UTSW 13 95668513 missense probably damaging 1.00
R1397:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1498:Iqgap2 UTSW 13 95646805 missense probably benign
R1513:Iqgap2 UTSW 13 95630010 missense probably damaging 1.00
R1630:Iqgap2 UTSW 13 95689785 missense probably benign
R2088:Iqgap2 UTSW 13 95891663 critical splice donor site probably null
R2928:Iqgap2 UTSW 13 95682236 missense probably benign
R3026:Iqgap2 UTSW 13 95673056 critical splice acceptor site probably null
R3720:Iqgap2 UTSW 13 95668528 splice site probably null
R3846:Iqgap2 UTSW 13 95673678 splice site probably benign
R4056:Iqgap2 UTSW 13 95750033 missense probably damaging 1.00
R4077:Iqgap2 UTSW 13 95657867 missense probably damaging 1.00
R4353:Iqgap2 UTSW 13 95671396 missense probably damaging 1.00
R4517:Iqgap2 UTSW 13 95664061 critical splice donor site probably null
R4628:Iqgap2 UTSW 13 95763329 missense probably benign 0.17
R4686:Iqgap2 UTSW 13 95721609 missense probably damaging 0.98
R4724:Iqgap2 UTSW 13 95635497 missense possibly damaging 0.73
R4826:Iqgap2 UTSW 13 95763275 missense probably damaging 1.00
R4847:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R4967:Iqgap2 UTSW 13 95630006 missense probably benign 0.00
R4973:Iqgap2 UTSW 13 95657797 splice site probably null
R5010:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R5086:Iqgap2 UTSW 13 95635580 missense probably benign 0.01
R5496:Iqgap2 UTSW 13 95630053 missense probably damaging 1.00
R5512:Iqgap2 UTSW 13 95675376 nonsense probably null
R5629:Iqgap2 UTSW 13 95632174 missense probably damaging 1.00
R5824:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5830:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5831:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5832:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5833:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5834:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5852:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5888:Iqgap2 UTSW 13 95635610 missense possibly damaging 0.89
R5889:Iqgap2 UTSW 13 95632042 missense probably benign 0.00
R6093:Iqgap2 UTSW 13 95628963 missense probably damaging 0.99
R6141:Iqgap2 UTSW 13 95721686 splice site probably null
R6404:Iqgap2 UTSW 13 95729477 missense probably benign 0.28
R6434:Iqgap2 UTSW 13 95682933 missense possibly damaging 0.85
R6648:Iqgap2 UTSW 13 95682211 missense probably benign 0.27
R6658:Iqgap2 UTSW 13 95660332 missense probably damaging 1.00
R6903:Iqgap2 UTSW 13 95661057 missense probably damaging 1.00
R7223:Iqgap2 UTSW 13 95628972 missense probably damaging 1.00
R7327:Iqgap2 UTSW 13 95635655 missense probably benign 0.00
R7371:Iqgap2 UTSW 13 95700338 splice site probably null
R7378:Iqgap2 UTSW 13 95732890 critical splice donor site probably null
R7441:Iqgap2 UTSW 13 95628076 missense probably benign 0.23
R7575:Iqgap2 UTSW 13 95661623 missense probably damaging 0.99
R7671:Iqgap2 UTSW 13 95628119 missense probably damaging 0.98
R7713:Iqgap2 UTSW 13 95731444 missense probably benign 0.01
R7806:Iqgap2 UTSW 13 95682257 missense probably benign 0.00
R7893:Iqgap2 UTSW 13 95689709 missense probably damaging 0.96
R8052:Iqgap2 UTSW 13 95657879 missense probably damaging 0.96
R8121:Iqgap2 UTSW 13 95724568 missense probably benign 0.00
R8261:Iqgap2 UTSW 13 95635570 missense probably damaging 1.00
R8301:Iqgap2 UTSW 13 95682151 critical splice donor site probably null
R8369:Iqgap2 UTSW 13 95661603 missense probably damaging 1.00
R8485:Iqgap2 UTSW 13 95660151 missense probably damaging 0.99
R8709:Iqgap2 UTSW 13 95660205 missense probably damaging 0.99
R8710:Iqgap2 UTSW 13 95660248 missense probably benign 0.24
R8737:Iqgap2 UTSW 13 95665750 missense probably damaging 1.00
R8845:Iqgap2 UTSW 13 95657884 missense possibly damaging 0.60
R8902:Iqgap2 UTSW 13 95682203 missense probably benign 0.16
R8957:Iqgap2 UTSW 13 95635646 missense probably damaging 1.00
R9153:Iqgap2 UTSW 13 95708039 missense probably benign
R9290:Iqgap2 UTSW 13 95750015 missense probably damaging 1.00
R9414:Iqgap2 UTSW 13 95646841 missense
R9432:Iqgap2 UTSW 13 95637753 missense probably benign
X0066:Iqgap2 UTSW 13 95671383 missense probably damaging 0.98
Z1176:Iqgap2 UTSW 13 95731443 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACCAGTGATCCGTAATCTAGGC -3'
(R):5'- CGATTGTCACCTTCTATTGCAG -3'

Sequencing Primer
(F):5'- GTGATCCGTAATCTAGGCTAAGCC -3'
(R):5'- GATTGTCACCTTCTATTGCAGATCAG -3'
Posted On 2022-03-25