Incidental Mutation 'R9259:Wapl'
ID 702126
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene Name WAPL cohesin release factor
Synonyms A530089A20Rik, Wapal
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9259 (G1)
Quality Score 190.009
Status Validated
Chromosome 14
Chromosomal Location 34673928-34747983 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 34741095 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 1131 (V1131L)
Ref Sequence ENSEMBL: ENSMUSP00000040232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
AlphaFold Q65Z40
Predicted Effect probably benign
Transcript: ENSMUST00000048263
AA Change: V1131L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: V1131L

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090027
AA Change: V1125L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: V1125L

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000117282
Gene: ENSMUSG00000041408
AA Change: V360L

DomainStartEndE-ValueType
Pfam:WAPL 1 281 1.1e-78 PFAM
coiled coil region 329 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169910
AA Change: V1131L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: V1131L

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000133779
Gene: ENSMUSG00000041408
AA Change: V149L

DomainStartEndE-ValueType
Pfam:WAPL 1 55 8.6e-22 PFAM
low complexity region 64 79 N/A INTRINSIC
coiled coil region 119 141 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,203,303 V1102A possibly damaging Het
Acot6 A G 12: 84,109,042 I255V possibly damaging Het
Adcy8 A T 15: 64,704,755 I986N probably damaging Het
Agr2 T A 12: 36,003,864 M164K probably damaging Het
Akap11 G A 14: 78,512,509 H813Y Het
Alas1 A T 9: 106,241,636 S195T probably benign Het
Aldoart1 T C 4: 72,852,443 T43A probably benign Het
Alms1 A G 6: 85,667,891 D2537G possibly damaging Het
Alpk3 A G 7: 81,093,554 T1040A probably damaging Het
Ankrd16 T C 2: 11,779,721 I120T probably damaging Het
Anks4b A G 7: 120,174,055 E46G probably benign Het
Ap3d1 A T 10: 80,723,827 V199E probably damaging Het
Atp1a3 A G 7: 24,997,531 S236P probably damaging Het
Atp5g2 T A 15: 102,663,126 N110I probably damaging Het
Cabin1 A G 10: 75,746,742 M280T probably benign Het
Cdc5l T C 17: 45,425,891 T134A possibly damaging Het
Clec4n C A 6: 123,235,465 P80Q probably damaging Het
Clip3 A G 7: 30,298,950 K274E probably benign Het
Cntrob A T 11: 69,320,839 D186E possibly damaging Het
Dcun1d3 A G 7: 119,857,829 V220A probably benign Het
Emsy A T 7: 98,593,550 N1127K probably benign Het
Entpd2 C T 2: 25,398,602 S206L probably damaging Het
Fam46c T C 3: 100,472,324 Y372C probably damaging Het
Fgd4 T C 16: 16,477,461 E218G probably damaging Het
Fkbp2 G T 19: 6,978,592 Q82K probably benign Het
Gpr161 T C 1: 165,310,456 Y204H probably damaging Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Gstt2 C T 10: 75,833,677 D59N possibly damaging Het
Havcr1 A T 11: 46,770,491 D206V probably damaging Het
Hoxb9 G A 11: 96,271,936 G132D probably damaging Het
Ifi44 C T 3: 151,749,238 V117M possibly damaging Het
Inhbe A G 10: 127,350,975 F112S probably damaging Het
Iqgap2 A T 13: 95,630,053 Y1481N probably damaging Het
Irak4 A T 15: 94,558,845 H303L probably damaging Het
Kdm5d A G Y: 942,640 E1435G possibly damaging Het
Kifc1 G T 17: 33,882,191 T599K possibly damaging Het
Klhl38 T C 15: 58,323,075 E86G probably benign Het
Mcub G C 3: 129,926,421 T141R probably benign Het
Moxd2 A T 6: 40,884,035 V274D probably damaging Het
Nol6 C T 4: 41,118,229 V803M possibly damaging Het
Olfr916 C T 9: 38,658,346 probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Pbld1 A G 10: 63,061,657 T46A possibly damaging Het
Peli3 T C 19: 4,934,458 D192G probably benign Het
Perm1 C T 4: 156,219,150 T717I probably benign Het
Pim1 G A 17: 29,491,207 A22T probably benign Het
Pkp2 C T 16: 16,225,850 P156L probably damaging Het
Ppwd1 G A 13: 104,223,104 R130C probably damaging Het
Prdm16 C A 4: 154,346,068 W321L possibly damaging Het
Ptprd T A 4: 76,071,963 D504V probably damaging Het
Pusl1 T C 4: 155,891,182 T65A probably damaging Het
Rtcb A G 10: 85,939,061 I490T probably damaging Het
Sec31b G T 19: 44,517,416 L967I probably damaging Het
Sec63 A C 10: 42,823,941 M666L probably benign Het
Sh3rf1 G C 8: 61,353,804 A379P probably benign Het
Slc7a12 T A 3: 14,481,316 L174I probably damaging Het
Sptbn4 C T 7: 27,367,699 S1935N possibly damaging Het
Susd6 A T 12: 80,851,256 Q55L probably benign Het
Tecpr2 A G 12: 110,931,433 E373G possibly damaging Het
Tm6sf2 A T 8: 70,077,935 I222L probably benign Het
Tsc22d1 T A 14: 76,417,044 V321E probably damaging Het
Tspoap1 A G 11: 87,779,524 N172S Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Vcan G A 13: 89,690,870 S2185F probably damaging Het
Zfp658 A G 7: 43,574,856 M852V probably benign Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34692636 missense probably benign 0.00
IGL00539:Wapl APN 14 34695008 missense probably damaging 1.00
IGL00846:Wapl APN 14 34692744 splice site probably benign
IGL01070:Wapl APN 14 34745622 unclassified probably benign
IGL01516:Wapl APN 14 34692081 missense probably damaging 1.00
IGL02021:Wapl APN 14 34722336 missense probably benign
IGL02209:Wapl APN 14 34677261 missense possibly damaging 0.46
IGL02309:Wapl APN 14 34744863 missense probably damaging 0.98
IGL02471:Wapl APN 14 34691920 missense possibly damaging 0.68
IGL02965:Wapl APN 14 34739224 intron probably benign
IGL03076:Wapl APN 14 34692089 missense probably benign 0.26
IGL03197:Wapl APN 14 34745631 missense possibly damaging 0.77
Mcclintock UTSW 14 34730662 critical splice donor site probably null
Tatum UTSW 14 34729195 missense probably damaging 1.00
R0045:Wapl UTSW 14 34733794 missense probably benign 0.18
R0278:Wapl UTSW 14 34692612 missense possibly damaging 0.68
R0335:Wapl UTSW 14 34692324 missense probably damaging 0.99
R1018:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R1295:Wapl UTSW 14 34724769 missense probably damaging 1.00
R1553:Wapl UTSW 14 34729190 missense probably damaging 1.00
R1868:Wapl UTSW 14 34692458 missense probably benign 0.00
R1909:Wapl UTSW 14 34691912 missense probably damaging 1.00
R2698:Wapl UTSW 14 34691777 missense probably benign
R2990:Wapl UTSW 14 34736708 missense probably damaging 0.98
R3121:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3122:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3147:Wapl UTSW 14 34725149 missense probably damaging 1.00
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3733:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3878:Wapl UTSW 14 34692147 missense probably damaging 1.00
R4034:Wapl UTSW 14 34737914 missense possibly damaging 0.92
R4934:Wapl UTSW 14 34692095 missense probably benign 0.11
R5079:Wapl UTSW 14 34724757 missense probably damaging 1.00
R5104:Wapl UTSW 14 34692059 nonsense probably null
R5113:Wapl UTSW 14 34724754 missense probably damaging 1.00
R5121:Wapl UTSW 14 34677162 missense probably benign 0.01
R5222:Wapl UTSW 14 34736685 nonsense probably null
R5299:Wapl UTSW 14 34733808 critical splice donor site probably null
R5387:Wapl UTSW 14 34677295 missense probably benign 0.00
R5541:Wapl UTSW 14 34730662 critical splice donor site probably null
R5618:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R5802:Wapl UTSW 14 34692320 missense probably damaging 1.00
R6029:Wapl UTSW 14 34739247 missense possibly damaging 0.94
R6292:Wapl UTSW 14 34729195 missense probably damaging 1.00
R6482:Wapl UTSW 14 34692692 missense probably benign 0.01
R6487:Wapl UTSW 14 34692292 missense probably damaging 1.00
R6925:Wapl UTSW 14 34677363 missense probably benign 0.31
R6937:Wapl UTSW 14 34722354 missense probably benign 0.01
R7080:Wapl UTSW 14 34692356 missense probably benign 0.03
R7203:Wapl UTSW 14 34736691 missense probably benign
R7944:Wapl UTSW 14 34677148 missense probably benign 0.00
R7945:Wapl UTSW 14 34677148 missense probably benign 0.00
R7969:Wapl UTSW 14 34730647 missense probably damaging 1.00
R8038:Wapl UTSW 14 34691682 missense probably benign
R8053:Wapl UTSW 14 34692321 missense probably damaging 1.00
R8688:Wapl UTSW 14 34692592 missense possibly damaging 0.94
R8864:Wapl UTSW 14 34692202 missense probably benign 0.03
R8988:Wapl UTSW 14 34729182 missense probably damaging 1.00
R9072:Wapl UTSW 14 34677460 missense possibly damaging 0.81
R9197:Wapl UTSW 14 34722287 missense probably damaging 1.00
R9545:Wapl UTSW 14 34677093 missense probably damaging 1.00
R9613:Wapl UTSW 14 34731563 missense probably benign 0.29
R9624:Wapl UTSW 14 34692106 missense possibly damaging 0.89
Z1177:Wapl UTSW 14 34745690 makesense probably null
Predicted Primers PCR Primer
(F):5'- CACTTTGTTATTGGTGACCTTCTAA -3'
(R):5'- GTCAGCCGCTCTTCTGAAATAAAA -3'

Sequencing Primer
(F):5'- TTGGTGACCTTCTAAAAACCAATC -3'
(R):5'- GCCGCTCTTCTGAAATAAAAAGCATG -3'
Posted On 2022-03-25