Incidental Mutation 'R9259:Wapl'
ID 702126
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene Name WAPL cohesin release factor
Synonyms A530089A20Rik, Wapal
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9259 (G1)
Quality Score 190.009
Status Validated
Chromosome 14
Chromosomal Location 34395885-34469940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 34463052 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 1131 (V1131L)
Ref Sequence ENSEMBL: ENSMUSP00000040232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
AlphaFold Q65Z40
Predicted Effect probably benign
Transcript: ENSMUST00000048263
AA Change: V1131L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: V1131L

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090027
AA Change: V1125L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: V1125L

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000117282
Gene: ENSMUSG00000041408
AA Change: V360L

DomainStartEndE-ValueType
Pfam:WAPL 1 281 1.1e-78 PFAM
coiled coil region 329 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169910
AA Change: V1131L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: V1131L

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000133779
Gene: ENSMUSG00000041408
AA Change: V149L

DomainStartEndE-ValueType
Pfam:WAPL 1 55 8.6e-22 PFAM
low complexity region 64 79 N/A INTRINSIC
coiled coil region 119 141 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot6 A G 12: 84,155,816 (GRCm39) I255V possibly damaging Het
Adcy8 A T 15: 64,576,604 (GRCm39) I986N probably damaging Het
Agr2 T A 12: 36,053,863 (GRCm39) M164K probably damaging Het
Akap11 G A 14: 78,749,949 (GRCm39) H813Y Het
Alas1 A T 9: 106,118,835 (GRCm39) S195T probably benign Het
Aldoart1 T C 4: 72,770,680 (GRCm39) T43A probably benign Het
Alms1 A G 6: 85,644,873 (GRCm39) D2537G possibly damaging Het
Alpk3 A G 7: 80,743,302 (GRCm39) T1040A probably damaging Het
Ankrd16 T C 2: 11,784,532 (GRCm39) I120T probably damaging Het
Anks4b A G 7: 119,773,278 (GRCm39) E46G probably benign Het
Ap3d1 A T 10: 80,559,661 (GRCm39) V199E probably damaging Het
Atp1a3 A G 7: 24,696,956 (GRCm39) S236P probably damaging Het
Atp5mc2 T A 15: 102,571,561 (GRCm39) N110I probably damaging Het
Cabin1 A G 10: 75,582,576 (GRCm39) M280T probably benign Het
Cdc5l T C 17: 45,736,817 (GRCm39) T134A possibly damaging Het
Clec4n C A 6: 123,212,424 (GRCm39) P80Q probably damaging Het
Clip3 A G 7: 29,998,375 (GRCm39) K274E probably benign Het
Cntrob A T 11: 69,211,665 (GRCm39) D186E possibly damaging Het
Cplane1 T C 15: 8,232,787 (GRCm39) V1102A possibly damaging Het
Dcun1d3 A G 7: 119,457,052 (GRCm39) V220A probably benign Het
Emsy A T 7: 98,242,757 (GRCm39) N1127K probably benign Het
Entpd2 C T 2: 25,288,614 (GRCm39) S206L probably damaging Het
Fgd4 T C 16: 16,295,325 (GRCm39) E218G probably damaging Het
Fkbp2 G T 19: 6,955,960 (GRCm39) Q82K probably benign Het
Gpr161 T C 1: 165,138,025 (GRCm39) Y204H probably damaging Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
Gstt2 C T 10: 75,669,511 (GRCm39) D59N possibly damaging Het
Havcr1 A T 11: 46,661,318 (GRCm39) D206V probably damaging Het
Hoxb9 G A 11: 96,162,762 (GRCm39) G132D probably damaging Het
Ifi44 C T 3: 151,454,875 (GRCm39) V117M possibly damaging Het
Inhbe A G 10: 127,186,844 (GRCm39) F112S probably damaging Het
Iqgap2 A T 13: 95,766,561 (GRCm39) Y1481N probably damaging Het
Irak4 A T 15: 94,456,726 (GRCm39) H303L probably damaging Het
Kdm5d A G Y: 942,640 (GRCm39) E1435G possibly damaging Het
Kifc1 G T 17: 34,101,165 (GRCm39) T599K possibly damaging Het
Klhl38 T C 15: 58,186,471 (GRCm39) E86G probably benign Het
Mcub G C 3: 129,720,070 (GRCm39) T141R probably benign Het
Moxd2 A T 6: 40,860,969 (GRCm39) V274D probably damaging Het
Nol6 C T 4: 41,118,229 (GRCm39) V803M possibly damaging Het
Or8b51 C T 9: 38,569,642 (GRCm39) probably benign Het
Ovgp1 T C 3: 105,893,883 (GRCm39) probably benign Het
Pbld1 A G 10: 62,897,436 (GRCm39) T46A possibly damaging Het
Peli3 T C 19: 4,984,486 (GRCm39) D192G probably benign Het
Perm1 C T 4: 156,303,607 (GRCm39) T717I probably benign Het
Pim1 G A 17: 29,710,181 (GRCm39) A22T probably benign Het
Pkp2 C T 16: 16,043,714 (GRCm39) P156L probably damaging Het
Ppwd1 G A 13: 104,359,612 (GRCm39) R130C probably damaging Het
Prdm16 C A 4: 154,430,525 (GRCm39) W321L possibly damaging Het
Ptprd T A 4: 75,990,200 (GRCm39) D504V probably damaging Het
Pusl1 T C 4: 155,975,639 (GRCm39) T65A probably damaging Het
Rtcb A G 10: 85,774,925 (GRCm39) I490T probably damaging Het
Sec31b G T 19: 44,505,855 (GRCm39) L967I probably damaging Het
Sec63 A C 10: 42,699,937 (GRCm39) M666L probably benign Het
Sh3rf1 G C 8: 61,806,838 (GRCm39) A379P probably benign Het
Slc7a12 T A 3: 14,546,376 (GRCm39) L174I probably damaging Het
Sptbn4 C T 7: 27,067,124 (GRCm39) S1935N possibly damaging Het
Susd6 A T 12: 80,898,030 (GRCm39) Q55L probably benign Het
Tecpr2 A G 12: 110,897,867 (GRCm39) E373G possibly damaging Het
Tent5c T C 3: 100,379,640 (GRCm39) Y372C probably damaging Het
Tm6sf2 A T 8: 70,530,585 (GRCm39) I222L probably benign Het
Tsc22d1 T A 14: 76,654,484 (GRCm39) V321E probably damaging Het
Tspoap1 A G 11: 87,670,350 (GRCm39) N172S Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 115,958,998 (GRCm39) probably benign Het
Vcan G A 13: 89,838,989 (GRCm39) S2185F probably damaging Het
Zfp658 A G 7: 43,224,280 (GRCm39) M852V probably benign Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34,414,593 (GRCm39) missense probably benign 0.00
IGL00539:Wapl APN 14 34,416,965 (GRCm39) missense probably damaging 1.00
IGL00846:Wapl APN 14 34,414,701 (GRCm39) splice site probably benign
IGL01070:Wapl APN 14 34,467,579 (GRCm39) unclassified probably benign
IGL01516:Wapl APN 14 34,414,038 (GRCm39) missense probably damaging 1.00
IGL02021:Wapl APN 14 34,444,293 (GRCm39) missense probably benign
IGL02209:Wapl APN 14 34,399,218 (GRCm39) missense possibly damaging 0.46
IGL02309:Wapl APN 14 34,466,820 (GRCm39) missense probably damaging 0.98
IGL02471:Wapl APN 14 34,413,877 (GRCm39) missense possibly damaging 0.68
IGL02965:Wapl APN 14 34,461,181 (GRCm39) intron probably benign
IGL03076:Wapl APN 14 34,414,046 (GRCm39) missense probably benign 0.26
IGL03197:Wapl APN 14 34,467,588 (GRCm39) missense possibly damaging 0.77
Mcclintock UTSW 14 34,452,619 (GRCm39) critical splice donor site probably null
Tatum UTSW 14 34,451,152 (GRCm39) missense probably damaging 1.00
R0045:Wapl UTSW 14 34,455,751 (GRCm39) missense probably benign 0.18
R0278:Wapl UTSW 14 34,414,569 (GRCm39) missense possibly damaging 0.68
R0335:Wapl UTSW 14 34,414,281 (GRCm39) missense probably damaging 0.99
R1018:Wapl UTSW 14 34,413,863 (GRCm39) missense possibly damaging 0.91
R1295:Wapl UTSW 14 34,446,726 (GRCm39) missense probably damaging 1.00
R1553:Wapl UTSW 14 34,451,147 (GRCm39) missense probably damaging 1.00
R1868:Wapl UTSW 14 34,414,415 (GRCm39) missense probably benign 0.00
R1909:Wapl UTSW 14 34,413,869 (GRCm39) missense probably damaging 1.00
R2698:Wapl UTSW 14 34,413,734 (GRCm39) missense probably benign
R2990:Wapl UTSW 14 34,458,665 (GRCm39) missense probably damaging 0.98
R3121:Wapl UTSW 14 34,451,172 (GRCm39) missense possibly damaging 0.93
R3122:Wapl UTSW 14 34,451,172 (GRCm39) missense possibly damaging 0.93
R3147:Wapl UTSW 14 34,447,106 (GRCm39) missense probably damaging 1.00
R3732:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3732:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3733:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3878:Wapl UTSW 14 34,414,104 (GRCm39) missense probably damaging 1.00
R4034:Wapl UTSW 14 34,459,871 (GRCm39) missense possibly damaging 0.92
R4934:Wapl UTSW 14 34,414,052 (GRCm39) missense probably benign 0.11
R5079:Wapl UTSW 14 34,446,714 (GRCm39) missense probably damaging 1.00
R5104:Wapl UTSW 14 34,414,016 (GRCm39) nonsense probably null
R5113:Wapl UTSW 14 34,446,711 (GRCm39) missense probably damaging 1.00
R5121:Wapl UTSW 14 34,399,119 (GRCm39) missense probably benign 0.01
R5222:Wapl UTSW 14 34,458,642 (GRCm39) nonsense probably null
R5299:Wapl UTSW 14 34,455,765 (GRCm39) critical splice donor site probably null
R5387:Wapl UTSW 14 34,399,252 (GRCm39) missense probably benign 0.00
R5541:Wapl UTSW 14 34,452,619 (GRCm39) critical splice donor site probably null
R5618:Wapl UTSW 14 34,413,863 (GRCm39) missense possibly damaging 0.91
R5802:Wapl UTSW 14 34,414,277 (GRCm39) missense probably damaging 1.00
R6029:Wapl UTSW 14 34,461,204 (GRCm39) missense possibly damaging 0.94
R6292:Wapl UTSW 14 34,451,152 (GRCm39) missense probably damaging 1.00
R6482:Wapl UTSW 14 34,414,649 (GRCm39) missense probably benign 0.01
R6487:Wapl UTSW 14 34,414,249 (GRCm39) missense probably damaging 1.00
R6925:Wapl UTSW 14 34,399,320 (GRCm39) missense probably benign 0.31
R6937:Wapl UTSW 14 34,444,311 (GRCm39) missense probably benign 0.01
R7080:Wapl UTSW 14 34,414,313 (GRCm39) missense probably benign 0.03
R7203:Wapl UTSW 14 34,458,648 (GRCm39) missense probably benign
R7944:Wapl UTSW 14 34,399,105 (GRCm39) missense probably benign 0.00
R7945:Wapl UTSW 14 34,399,105 (GRCm39) missense probably benign 0.00
R7969:Wapl UTSW 14 34,452,604 (GRCm39) missense probably damaging 1.00
R8038:Wapl UTSW 14 34,413,639 (GRCm39) missense probably benign
R8053:Wapl UTSW 14 34,414,278 (GRCm39) missense probably damaging 1.00
R8688:Wapl UTSW 14 34,414,549 (GRCm39) missense possibly damaging 0.94
R8864:Wapl UTSW 14 34,414,159 (GRCm39) missense probably benign 0.03
R8988:Wapl UTSW 14 34,451,139 (GRCm39) missense probably damaging 1.00
R9072:Wapl UTSW 14 34,399,417 (GRCm39) missense possibly damaging 0.81
R9197:Wapl UTSW 14 34,444,244 (GRCm39) missense probably damaging 1.00
R9545:Wapl UTSW 14 34,399,050 (GRCm39) missense probably damaging 1.00
R9613:Wapl UTSW 14 34,453,520 (GRCm39) missense probably benign 0.29
R9624:Wapl UTSW 14 34,414,063 (GRCm39) missense possibly damaging 0.89
Z1177:Wapl UTSW 14 34,467,647 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- CACTTTGTTATTGGTGACCTTCTAA -3'
(R):5'- GTCAGCCGCTCTTCTGAAATAAAA -3'

Sequencing Primer
(F):5'- TTGGTGACCTTCTAAAAACCAATC -3'
(R):5'- GCCGCTCTTCTGAAATAAAAAGCATG -3'
Posted On 2022-03-25