Incidental Mutation 'R9260:Optn'
ID 702147
Institutional Source Beutler Lab
Gene Symbol Optn
Ensembl Gene ENSMUSG00000026672
Gene Name optineurin
Synonyms TFIIIA-INTP, 4930441O07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock # R9260 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 5020642-5064051 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 5040265 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 222 (C222Y)
Ref Sequence ENSEMBL: ENSMUSP00000027986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027986] [ENSMUST00000114996]
AlphaFold Q8K3K8
Predicted Effect probably benign
Transcript: ENSMUST00000027986
AA Change: C222Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027986
Gene: ENSMUSG00000026672
AA Change: C222Y

DomainStartEndE-ValueType
Pfam:NEMO 37 104 2e-27 PFAM
coiled coil region 243 278 N/A INTRINSIC
PDB:2ZVO|D 424 512 2e-11 PDB
PDB:2LO4|A 551 584 4e-15 PDB
Blast:ZnF_C2H2 560 580 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000114996
AA Change: C222Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110648
Gene: ENSMUSG00000026672
AA Change: C222Y

DomainStartEndE-ValueType
Pfam:NEMO 37 104 2e-27 PFAM
coiled coil region 243 278 N/A INTRINSIC
Pfam:CC2-LZ 407 510 3.2e-33 PFAM
PDB:2LO4|A 551 584 4e-15 PDB
Blast:ZnF_C2H2 560 580 2e-6 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the coiled-coil containing protein optineurin. Optineurin may play a role in normal-tension glaucoma and adult-onset primary open angle glaucoma. Optineurin interacts with adenovirus E3-14.7K protein and may utilize tumor necrosis factor-alpha or Fas-ligand pathways to mediate apoptosis, inflammation or vasoconstriction. Optineurin may also function in cellular morphogenesis and membrane trafficking, vesicle trafficking, and transcription activation through its interactions with the RAB8, huntingtin, and transcription factor IIIA proteins. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice hypomorphic allele exhibit background sensitive embryonic lethality with surviving mice exhibiting normal immune cell development, T and B cell activation and TNF- or LPS-mediated activation of cells of the innate immune system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,316 H369Q unknown Het
Atp1a4 A G 1: 172,246,792 I298T probably damaging Het
Bmper T A 9: 23,406,720 L545H probably benign Het
Cacnb3 A G 15: 98,639,557 S39G probably benign Het
Casr T C 16: 36,509,964 K336R probably benign Het
Ccdc141 C A 2: 77,014,451 G1424V probably damaging Het
Cd101 A T 3: 101,013,283 D437E probably benign Het
Chadl A G 15: 81,693,857 S524P probably damaging Het
Clec4a4 C T 6: 123,023,936 R203* probably null Het
Cntnap4 A G 8: 112,773,644 I523V probably benign Het
Cpb1 T A 3: 20,262,474 Y304F probably damaging Het
Dnajc14 T G 10: 128,806,897 S229R possibly damaging Het
Dnajc15 A G 14: 77,844,399 V101A possibly damaging Het
Dpyd A T 3: 119,314,798 Y830F possibly damaging Het
Ehbp1l1 A G 19: 5,719,250 V675A probably benign Het
F10 G A 8: 13,055,638 C413Y probably damaging Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Frem2 G C 3: 53,652,783 S1434R probably damaging Het
Gli3 G T 13: 15,725,090 V1021F probably damaging Het
Gm7168 A T 17: 13,949,226 N285I probably benign Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Herc1 T A 9: 66,418,409 C1388* probably null Het
Hfe2 T A 3: 96,528,263 I279N probably damaging Het
Igfn1 T C 1: 135,979,956 E217G probably benign Het
Ighv1-59 T C 12: 115,335,117 T106A probably benign Het
Igkv6-23 T A 6: 70,260,473 I95F probably damaging Het
Il31ra A T 13: 112,531,668 S456T probably damaging Het
Ints3 T C 3: 90,401,161 D610G probably damaging Het
Iqcg G A 16: 33,035,603 Q201* probably null Het
Kat14 T A 2: 144,393,521 D300E probably benign Het
Kbtbd13 T C 9: 65,391,570 H28R possibly damaging Het
Kcnh2 A T 5: 24,323,071 D866E probably damaging Het
Kdm4b A G 17: 56,394,775 T595A probably benign Het
Lct C T 1: 128,299,967 W1263* probably null Het
Lexm T C 4: 106,615,437 K84E probably benign Het
Micall2 T A 5: 139,709,698 M905L unknown Het
Mobp A G 9: 120,168,506 T164A unknown Het
Mtrr T C 13: 68,580,555 E42G possibly damaging Het
Muc5b T A 7: 141,851,518 W888R unknown Het
Myh7 G A 14: 54,987,385 A575V probably damaging Het
Nbea A C 3: 55,983,812 L1612W possibly damaging Het
Notch3 A G 17: 32,143,242 probably null Het
Nsun4 T C 4: 116,044,810 Y153C probably damaging Het
Nup210 A G 6: 91,062,803 I690T probably benign Het
Oaz1 T A 10: 80,826,769 S4T possibly damaging Het
Olfr1293-ps T A 2: 111,527,926 V222E Het
Olfr19 A T 16: 16,673,473 C169* probably null Het
Olfr201 T C 16: 59,269,314 M118V probably damaging Het
Olfr266 A G 3: 106,822,194 S122P probably damaging Het
Olfr813 G A 10: 129,856,589 V24M probably benign Het
Osmr T A 15: 6,852,552 H37L probably benign Het
Pccb G T 9: 100,995,590 P287Q probably benign Het
Pclo T A 5: 14,714,273 D4253E unknown Het
Pdcd6ip A T 9: 113,697,504 probably null Het
Pde9a T C 17: 31,459,163 probably null Het
Pdk2 C A 11: 95,039,434 V59F probably damaging Het
Pgm2 T A 4: 99,969,989 V362E probably damaging Het
Pmepa1 CCGGCGGCGGCGGCGGCGG CCGGCGGCGGCGGCGG 2: 173,276,150 probably benign Het
Pold4 T C 19: 4,232,850 F97S possibly damaging Het
Ppp5c C T 7: 17,006,961 V361I probably benign Het
Prrt1 A G 17: 34,631,146 Y178C probably damaging Het
Psmb11 A T 14: 54,625,576 I84F probably damaging Het
Smg7 A G 1: 152,861,798 S131P probably damaging Het
Snrnp200 T A 2: 127,236,508 L1728Q probably damaging Het
Stbd1 A T 5: 92,605,597 E315D probably damaging Het
Tcaf1 C T 6: 42,686,620 G109R possibly damaging Het
Thap12 C T 7: 98,707,073 R56* probably null Het
Ttn T C 2: 76,815,575 E12848G probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Uqcrfs1 G A 13: 30,541,125 A144V probably damaging Het
Wdr19 T A 5: 65,206,446 D67E possibly damaging Het
Zkscan3 A T 13: 21,394,040 W226R probably damaging Het
Zmym5 A C 14: 56,804,184 F154C probably damaging Het
Other mutations in Optn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Optn APN 2 5033156 missense possibly damaging 0.93
IGL01433:Optn APN 2 5027144 missense probably benign 0.07
IGL01480:Optn APN 2 5046018 missense probably benign 0.01
IGL01863:Optn APN 2 5021487 splice site probably benign
IGL02108:Optn APN 2 5031273 missense possibly damaging 0.91
IGL02150:Optn APN 2 5033152 missense probably damaging 0.97
IGL02623:Optn APN 2 5035022 missense probably damaging 1.00
R0119:Optn UTSW 2 5024115 missense probably damaging 1.00
R0121:Optn UTSW 2 5024115 missense probably damaging 1.00
R0330:Optn UTSW 2 5034255 missense possibly damaging 0.53
R0332:Optn UTSW 2 5024115 missense probably damaging 1.00
R0335:Optn UTSW 2 5024115 missense probably damaging 1.00
R0390:Optn UTSW 2 5046195 missense probably benign
R0437:Optn UTSW 2 5024115 missense probably damaging 1.00
R1710:Optn UTSW 2 5053130 missense possibly damaging 0.90
R2229:Optn UTSW 2 5024117 missense probably damaging 1.00
R3237:Optn UTSW 2 5034203 missense probably damaging 1.00
R3740:Optn UTSW 2 5034198 missense possibly damaging 0.51
R3741:Optn UTSW 2 5034198 missense possibly damaging 0.51
R4667:Optn UTSW 2 5033139 missense probably benign 0.20
R4783:Optn UTSW 2 5054627 missense probably benign
R4965:Optn UTSW 2 5021379 missense probably benign 0.14
R5121:Optn UTSW 2 5046106 missense probably benign 0.25
R6119:Optn UTSW 2 5021323 splice site probably null
R7024:Optn UTSW 2 5052837 splice site probably null
R7167:Optn UTSW 2 5042483 missense probably benign 0.00
R7685:Optn UTSW 2 5054650 missense probably benign 0.01
R8103:Optn UTSW 2 5040202 missense probably damaging 0.97
R8267:Optn UTSW 2 5054651 missense probably benign 0.00
R8844:Optn UTSW 2 5027112 critical splice donor site probably null
R9082:Optn UTSW 2 5054640 missense probably damaging 1.00
R9141:Optn UTSW 2 5054674 missense possibly damaging 0.93
R9238:Optn UTSW 2 5053140 missense probably damaging 1.00
R9287:Optn UTSW 2 5031315 missense probably damaging 0.98
R9426:Optn UTSW 2 5054674 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCCTAAGATGTACTGTGGCAGAG -3'
(R):5'- GCGTACAAGGATTGGCTCAG -3'

Sequencing Primer
(F):5'- TGCACTGCCTCACATGGTG -3'
(R):5'- ACAAGGATTGGCTCAGCTGTG -3'
Posted On 2022-03-25