Incidental Mutation 'R9260:Ccdc141'
ID 702149
Institutional Source Beutler Lab
Gene Symbol Ccdc141
Ensembl Gene ENSMUSG00000044033
Gene Name coiled-coil domain containing 141
Synonyms ENSMUSG00000075261, 2610301F02Rik, CAMDI
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9260 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 77009902-77170636 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 77014451 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 1424 (G1424V)
Ref Sequence ENSEMBL: ENSMUSP00000052945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049544] [ENSMUST00000164114]
AlphaFold E9Q8Q6
Predicted Effect probably damaging
Transcript: ENSMUST00000049544
AA Change: G1424V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052945
Gene: ENSMUSG00000044033
AA Change: G1424V

DomainStartEndE-ValueType
SPEC 26 128 2.87e-1 SMART
Blast:SPEC 132 222 1e-40 BLAST
low complexity region 223 251 N/A INTRINSIC
SPEC 252 353 3.61e-1 SMART
Blast:SPEC 356 453 2e-49 BLAST
Blast:SPEC 461 562 1e-16 BLAST
low complexity region 569 583 N/A INTRINSIC
Blast:SPEC 688 772 7e-30 BLAST
low complexity region 773 785 N/A INTRINSIC
Blast:SPEC 790 894 2e-24 BLAST
Blast:SPEC 907 1009 4e-44 BLAST
Blast:SPEC 1012 1118 9e-63 BLAST
low complexity region 1203 1231 N/A INTRINSIC
Blast:IG 1305 1416 5e-54 BLAST
SCOP:d1g1ca_ 1406 1443 1e-9 SMART
Blast:IG 1416 1444 2e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000164114
AA Change: G1424V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128736
Gene: ENSMUSG00000044033
AA Change: G1424V

DomainStartEndE-ValueType
SPEC 26 128 2.87e-1 SMART
Blast:SPEC 132 222 2e-40 BLAST
low complexity region 223 251 N/A INTRINSIC
SPEC 252 353 3.61e-1 SMART
Blast:SPEC 356 453 2e-49 BLAST
Blast:SPEC 461 562 1e-16 BLAST
low complexity region 569 583 N/A INTRINSIC
Blast:SPEC 688 772 7e-30 BLAST
low complexity region 773 785 N/A INTRINSIC
Blast:SPEC 790 894 3e-24 BLAST
Blast:SPEC 907 1009 4e-44 BLAST
Blast:SPEC 1012 1118 1e-62 BLAST
low complexity region 1203 1231 N/A INTRINSIC
IGc2 1422 1489 1.27e-5 SMART
transmembrane domain 1510 1529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179868
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (77/77)
MGI Phenotype PHENOTYPE: Homozygous knockout impairs migration of neurons in the somatosensory cortex, resulting in increased anxiety and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,316 H369Q unknown Het
Atp1a4 A G 1: 172,246,792 I298T probably damaging Het
Bmper T A 9: 23,406,720 L545H probably benign Het
Cacnb3 A G 15: 98,639,557 S39G probably benign Het
Casr T C 16: 36,509,964 K336R probably benign Het
Cd101 A T 3: 101,013,283 D437E probably benign Het
Chadl A G 15: 81,693,857 S524P probably damaging Het
Clec4a4 C T 6: 123,023,936 R203* probably null Het
Cntnap4 A G 8: 112,773,644 I523V probably benign Het
Cpb1 T A 3: 20,262,474 Y304F probably damaging Het
Dnajc14 T G 10: 128,806,897 S229R possibly damaging Het
Dnajc15 A G 14: 77,844,399 V101A possibly damaging Het
Dpyd A T 3: 119,314,798 Y830F possibly damaging Het
Ehbp1l1 A G 19: 5,719,250 V675A probably benign Het
F10 G A 8: 13,055,638 C413Y probably damaging Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Fpr1 A T 17: 17,877,744 probably benign Het
Frem2 G C 3: 53,652,783 S1434R probably damaging Het
Gli3 G T 13: 15,725,090 V1021F probably damaging Het
Gm7168 A T 17: 13,949,226 N285I probably benign Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Herc1 T A 9: 66,418,409 C1388* probably null Het
Hfe2 T A 3: 96,528,263 I279N probably damaging Het
Hikeshi T C 7: 89,930,568 probably benign Het
Igfn1 T C 1: 135,979,956 E217G probably benign Het
Ighv1-59 T C 12: 115,335,117 T106A probably benign Het
Igkv6-23 T A 6: 70,260,473 I95F probably damaging Het
Il31ra A T 13: 112,531,668 S456T probably damaging Het
Ints3 T C 3: 90,401,161 D610G probably damaging Het
Iqcg G A 16: 33,035,603 Q201* probably null Het
Kat14 T A 2: 144,393,521 D300E probably benign Het
Kbtbd13 T C 9: 65,391,570 H28R possibly damaging Het
Kcnh2 A T 5: 24,323,071 D866E probably damaging Het
Kdm4b A G 17: 56,394,775 T595A probably benign Het
Lct C T 1: 128,299,967 W1263* probably null Het
Lexm T C 4: 106,615,437 K84E probably benign Het
Micall2 T A 5: 139,709,698 M905L unknown Het
Mkrn1 T C 6: 39,405,596 probably benign Het
Mobp A G 9: 120,168,506 T164A unknown Het
Mtrr T C 13: 68,580,555 E42G possibly damaging Het
Muc5b T A 7: 141,851,518 W888R unknown Het
Myh7 G A 14: 54,987,385 A575V probably damaging Het
Nbea A C 3: 55,983,812 L1612W possibly damaging Het
Notch3 A G 17: 32,143,242 probably null Het
Nsun4 T C 4: 116,044,810 Y153C probably damaging Het
Nup210 A G 6: 91,062,803 I690T probably benign Het
Nyap2 T A 1: 81,087,118 probably benign Het
Oaz1 T A 10: 80,826,769 S4T possibly damaging Het
Olfr1293-ps T A 2: 111,527,926 V222E Het
Olfr19 A T 16: 16,673,473 C169* probably null Het
Olfr201 T C 16: 59,269,314 M118V probably damaging Het
Olfr266 A G 3: 106,822,194 S122P probably damaging Het
Olfr813 G A 10: 129,856,589 V24M probably benign Het
Optn C T 2: 5,040,265 C222Y probably benign Het
Osmr T A 15: 6,852,552 H37L probably benign Het
Pccb G T 9: 100,995,590 P287Q probably benign Het
Pclo T A 5: 14,714,273 D4253E unknown Het
Pdcd6ip A T 9: 113,697,504 probably null Het
Pde9a T C 17: 31,459,163 probably null Het
Pdk2 C A 11: 95,039,434 V59F probably damaging Het
Pgm2 T A 4: 99,969,989 V362E probably damaging Het
Pmepa1 CCGGCGGCGGCGGCGGCGG CCGGCGGCGGCGGCGG 2: 173,276,150 probably benign Het
Pold4 T C 19: 4,232,850 F97S possibly damaging Het
Ppp5c C T 7: 17,006,961 V361I probably benign Het
Prrt1 A G 17: 34,631,146 Y178C probably damaging Het
Psmb11 A T 14: 54,625,576 I84F probably damaging Het
Smg7 A G 1: 152,861,798 S131P probably damaging Het
Snrnp200 T A 2: 127,236,508 L1728Q probably damaging Het
Stbd1 A T 5: 92,605,597 E315D probably damaging Het
Tcaf1 C T 6: 42,686,620 G109R possibly damaging Het
Thap12 C T 7: 98,707,073 R56* probably null Het
Ttn T C 2: 76,815,575 E12848G probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Uqcrfs1 G A 13: 30,541,125 A144V probably damaging Het
Usp13 T A 3: 32,901,760 probably benign Het
Wdr19 T A 5: 65,206,446 D67E possibly damaging Het
Zkscan3 A T 13: 21,394,040 W226R probably damaging Het
Zmym5 A C 14: 56,804,184 F154C probably damaging Het
Other mutations in Ccdc141
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Ccdc141 APN 2 77054644 missense probably damaging 0.98
IGL01396:Ccdc141 APN 2 77128325 missense possibly damaging 0.87
IGL01408:Ccdc141 APN 2 77045679 missense probably benign 0.01
IGL01633:Ccdc141 APN 2 77089249 missense probably benign 0.01
IGL01982:Ccdc141 APN 2 77030659 missense probably damaging 1.00
IGL02105:Ccdc141 APN 2 77049577 critical splice donor site probably null
IGL02307:Ccdc141 APN 2 77029342 missense probably damaging 1.00
IGL02645:Ccdc141 APN 2 77074867 nonsense probably null
IGL02737:Ccdc141 APN 2 77057924 missense probably damaging 0.97
IGL02740:Ccdc141 APN 2 77054609 missense probably benign 0.05
IGL02949:Ccdc141 APN 2 77027594 missense probably damaging 1.00
IGL03127:Ccdc141 APN 2 77029235 critical splice donor site probably null
Verloren UTSW 2 77027648 missense probably damaging 1.00
Verschied UTSW 2 77108356 splice site probably benign
R0153:Ccdc141 UTSW 2 77165238 intron probably benign
R0384:Ccdc141 UTSW 2 77027648 missense probably damaging 1.00
R0423:Ccdc141 UTSW 2 77039450 missense probably damaging 0.96
R0573:Ccdc141 UTSW 2 77039493 missense probably benign 0.00
R1332:Ccdc141 UTSW 2 77014440 missense probably damaging 1.00
R1336:Ccdc141 UTSW 2 77014440 missense probably damaging 1.00
R1355:Ccdc141 UTSW 2 77030601 missense probably damaging 1.00
R1416:Ccdc141 UTSW 2 77014796 missense probably damaging 1.00
R1659:Ccdc141 UTSW 2 77054683 missense probably benign 0.41
R1726:Ccdc141 UTSW 2 77108356 splice site probably benign
R1799:Ccdc141 UTSW 2 77011671 missense possibly damaging 0.88
R1837:Ccdc141 UTSW 2 77011665 missense probably benign 0.00
R1839:Ccdc141 UTSW 2 77011665 missense probably benign 0.00
R1918:Ccdc141 UTSW 2 77014703 missense probably benign 0.00
R2019:Ccdc141 UTSW 2 77011565 missense probably damaging 1.00
R2133:Ccdc141 UTSW 2 77059607 missense probably benign 0.28
R2158:Ccdc141 UTSW 2 77030671 missense probably damaging 1.00
R2256:Ccdc141 UTSW 2 77132262 missense probably damaging 1.00
R2359:Ccdc141 UTSW 2 77170402 missense probably damaging 1.00
R2382:Ccdc141 UTSW 2 77011542 missense probably damaging 1.00
R2382:Ccdc141 UTSW 2 77074998 missense probably benign 0.11
R3110:Ccdc141 UTSW 2 77039486 missense probably benign 0.31
R3112:Ccdc141 UTSW 2 77039486 missense probably benign 0.31
R4334:Ccdc141 UTSW 2 77170432 missense probably damaging 1.00
R4493:Ccdc141 UTSW 2 77132297 missense probably damaging 1.00
R4494:Ccdc141 UTSW 2 77132297 missense probably damaging 1.00
R4628:Ccdc141 UTSW 2 77059680 missense probably benign 0.02
R4748:Ccdc141 UTSW 2 77057980 missense possibly damaging 0.67
R4810:Ccdc141 UTSW 2 77045755 missense possibly damaging 0.73
R4824:Ccdc141 UTSW 2 77124336 missense probably damaging 0.99
R4829:Ccdc141 UTSW 2 77074916 missense probably damaging 0.99
R4920:Ccdc141 UTSW 2 77168563 missense probably damaging 1.00
R5024:Ccdc141 UTSW 2 77054703 missense probably benign 0.17
R5073:Ccdc141 UTSW 2 77124378 splice site probably null
R5251:Ccdc141 UTSW 2 77027774 missense probably damaging 1.00
R5252:Ccdc141 UTSW 2 77132249 missense probably benign 0.03
R5534:Ccdc141 UTSW 2 77057897 missense probably benign
R5539:Ccdc141 UTSW 2 77015093 missense probably damaging 0.98
R5551:Ccdc141 UTSW 2 77014409 missense probably damaging 1.00
R5784:Ccdc141 UTSW 2 77029327 missense probably damaging 1.00
R5837:Ccdc141 UTSW 2 77108437 missense possibly damaging 0.56
R5850:Ccdc141 UTSW 2 77029403 missense probably damaging 0.98
R6050:Ccdc141 UTSW 2 77011731 missense probably benign 0.33
R6263:Ccdc141 UTSW 2 77108463 missense probably damaging 1.00
R6502:Ccdc141 UTSW 2 77170401 missense probably damaging 1.00
R6580:Ccdc141 UTSW 2 77011755 missense possibly damaging 0.50
R6865:Ccdc141 UTSW 2 77029235 critical splice donor site probably null
R7014:Ccdc141 UTSW 2 77132297 missense probably damaging 1.00
R7094:Ccdc141 UTSW 2 77041453 missense possibly damaging 0.83
R7195:Ccdc141 UTSW 2 77049583 missense probably benign 0.39
R7300:Ccdc141 UTSW 2 77014694 missense probably benign 0.00
R7654:Ccdc141 UTSW 2 77042478 missense probably benign 0.05
R7834:Ccdc141 UTSW 2 77059545 missense possibly damaging 0.81
R7868:Ccdc141 UTSW 2 77108412 missense probably damaging 0.99
R7986:Ccdc141 UTSW 2 77015117 missense probably benign 0.01
R8059:Ccdc141 UTSW 2 77044751 missense probably damaging 1.00
R8082:Ccdc141 UTSW 2 77124244 missense probably damaging 0.99
R8439:Ccdc141 UTSW 2 77059550 missense possibly damaging 0.82
R8508:Ccdc141 UTSW 2 77132244 missense probably benign 0.01
R8695:Ccdc141 UTSW 2 77049619 missense probably benign 0.03
R8880:Ccdc141 UTSW 2 77015212 missense probably benign 0.28
R8992:Ccdc141 UTSW 2 77014395 missense probably damaging 1.00
R9048:Ccdc141 UTSW 2 77023528 missense probably damaging 1.00
R9297:Ccdc141 UTSW 2 77011684 missense probably benign 0.34
R9418:Ccdc141 UTSW 2 77041422 missense probably benign 0.05
R9628:Ccdc141 UTSW 2 77014494 missense probably damaging 1.00
Z1088:Ccdc141 UTSW 2 77128272 missense probably benign 0.03
Z1177:Ccdc141 UTSW 2 77015149 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACCAAAGCATGCAGGGTTG -3'
(R):5'- GCTGATTCTAACGTCACTAAAACCC -3'

Sequencing Primer
(F):5'- CAAAGCATGCAGGGTTGAGTGTC -3'
(R):5'- CAAGACAGGCTGCATGCTG -3'
Posted On 2022-03-25