Incidental Mutation 'R0748:S100a9'
ID70215
Institutional Source Beutler Lab
Gene Symbol S100a9
Ensembl Gene ENSMUSG00000056071
Gene NameS100 calcium binding protein A9 (calgranulin B)
Synonyms60B8Ag, GAGB, Cagb, p14, MRP14, BEE22, L1Ag
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R0748 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location90692632-90695721 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90692891 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 66 (D66G)
Ref Sequence ENSEMBL: ENSMUSP00000112843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069960] [ENSMUST00000117167]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069960
AA Change: D66G

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000070842
Gene: ENSMUSG00000056071
AA Change: D66G

DomainStartEndE-ValueType
Pfam:S_100 9 51 6.7e-23 PFAM
low complexity region 102 113 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117167
AA Change: D66G

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112843
Gene: ENSMUSG00000056071
AA Change: D66G

DomainStartEndE-ValueType
Pfam:S_100 9 52 5.2e-24 PFAM
low complexity region 102 113 N/A INTRINSIC
Meta Mutation Damage Score 0.1856 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in the inhibition of casein kinase and altered expression of this protein is associated with the disease cystic fibrosis. This antimicrobial protein exhibits antifungal and antibacterial activity. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for one null allele exhibit abnormal immune physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,196,876 V718A probably damaging Het
Amigo1 A G 3: 108,188,630 S482G probably damaging Het
F2rl3 A G 8: 72,762,751 Q202R probably benign Het
Faap100 A G 11: 120,372,171 V787A probably damaging Het
Fat4 A T 3: 38,887,828 Q290L possibly damaging Het
Flnc A G 6: 29,446,344 E920G probably damaging Het
Gm9881 T C 16: 91,170,425 N137S unknown Het
Hps4 A G 5: 112,374,914 E546G probably damaging Het
Htr2b A G 1: 86,110,806 I26T probably benign Het
Insr A C 8: 3,258,841 M65R probably damaging Het
Kif20a T C 18: 34,628,188 probably benign Het
L3mbtl1 A T 2: 162,971,163 probably benign Het
L3mbtl1 A C 2: 162,971,164 probably null Het
Lcn4 T C 2: 26,668,347 I175M probably damaging Het
Malt1 T A 18: 65,475,260 probably null Het
Nufip1 T C 14: 76,111,068 S46P probably damaging Het
Nup93 T A 8: 94,307,943 Y629N probably damaging Het
Olfr517 C A 7: 108,869,150 M1I probably null Het
Pcsk6 T C 7: 66,038,968 probably benign Het
Rdx G C 9: 52,064,860 V33L possibly damaging Het
Rnf213 T C 11: 119,473,480 L4535P probably damaging Het
Rorb T A 19: 18,977,800 T66S probably damaging Het
Sacs T C 14: 61,209,265 I2920T probably damaging Het
Safb2 T C 17: 56,575,580 N351S probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Unc13b G A 4: 43,241,164 probably benign Het
Vars A G 17: 34,998,012 S489P probably damaging Het
Wars2 A G 3: 99,216,572 K250E probably damaging Het
Zfp292 A G 4: 34,816,424 probably benign Het
Other mutations in S100a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:S100a9 APN 3 90692768 missense probably benign 0.23
IGL02343:S100a9 APN 3 90695224 missense probably damaging 1.00
R4365:S100a9 UTSW 3 90692774 missense unknown
R5919:S100a9 UTSW 3 90695188 missense probably damaging 1.00
R5953:S100a9 UTSW 3 90692927 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCCATTGAGTAAGCCATTCCC -3'
(R):5'- AGCATCTGCTCCATCATGAGCAC -3'

Sequencing Primer
(F):5'- GAGTAAGCCATTCCCTTTAGACTTG -3'
(R):5'- CATGAGCACTCAGTACGTTATTC -3'
Posted On2013-09-30