Incidental Mutation 'R9260:Cpb1'
ID 702154
Institutional Source Beutler Lab
Gene Symbol Cpb1
Ensembl Gene ENSMUSG00000011463
Gene Name carboxypeptidase B1 (tissue)
Synonyms 1810063F02Rik, 0910001A18Rik, 2210008M23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9260 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 20248264-20275733 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20262474 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 304 (Y304F)
Ref Sequence ENSEMBL: ENSMUSP00000011607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011607]
AlphaFold B2RS76
Predicted Effect probably damaging
Transcript: ENSMUST00000011607
AA Change: Y304F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000011607
Gene: ENSMUSG00000011463
AA Change: Y304F

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Propep_M14 26 102 2.4e-19 PFAM
Zn_pept 117 398 2.08e-147 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137855
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Three different procarboxypeptidases A and two different procarboxypeptidases B have been isolated. The B1 and B2 forms differ from each other mainly in isoelectric point. Carboxypeptidase B1 is a highly tissue-specific protein and is a useful serum marker for acute pancreatitis and dysfunction of pancreatic transplants. It is not elevated in pancreatic carcinoma. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,316 H369Q unknown Het
Atp1a4 A G 1: 172,246,792 I298T probably damaging Het
Bmper T A 9: 23,406,720 L545H probably benign Het
Cacnb3 A G 15: 98,639,557 S39G probably benign Het
Casr T C 16: 36,509,964 K336R probably benign Het
Ccdc141 C A 2: 77,014,451 G1424V probably damaging Het
Cd101 A T 3: 101,013,283 D437E probably benign Het
Chadl A G 15: 81,693,857 S524P probably damaging Het
Clec4a4 C T 6: 123,023,936 R203* probably null Het
Cntnap4 A G 8: 112,773,644 I523V probably benign Het
Dnajc14 T G 10: 128,806,897 S229R possibly damaging Het
Dnajc15 A G 14: 77,844,399 V101A possibly damaging Het
Dpyd A T 3: 119,314,798 Y830F possibly damaging Het
Ehbp1l1 A G 19: 5,719,250 V675A probably benign Het
F10 G A 8: 13,055,638 C413Y probably damaging Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Fpr1 A T 17: 17,877,744 probably benign Het
Frem2 G C 3: 53,652,783 S1434R probably damaging Het
Gli3 G T 13: 15,725,090 V1021F probably damaging Het
Gm7168 A T 17: 13,949,226 N285I probably benign Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Herc1 T A 9: 66,418,409 C1388* probably null Het
Hfe2 T A 3: 96,528,263 I279N probably damaging Het
Hikeshi T C 7: 89,930,568 probably benign Het
Igfn1 T C 1: 135,979,956 E217G probably benign Het
Ighv1-59 T C 12: 115,335,117 T106A probably benign Het
Igkv6-23 T A 6: 70,260,473 I95F probably damaging Het
Il31ra A T 13: 112,531,668 S456T probably damaging Het
Ints3 T C 3: 90,401,161 D610G probably damaging Het
Iqcg G A 16: 33,035,603 Q201* probably null Het
Kat14 T A 2: 144,393,521 D300E probably benign Het
Kbtbd13 T C 9: 65,391,570 H28R possibly damaging Het
Kcnh2 A T 5: 24,323,071 D866E probably damaging Het
Kdm4b A G 17: 56,394,775 T595A probably benign Het
Lct C T 1: 128,299,967 W1263* probably null Het
Lexm T C 4: 106,615,437 K84E probably benign Het
Micall2 T A 5: 139,709,698 M905L unknown Het
Mkrn1 T C 6: 39,405,596 probably benign Het
Mobp A G 9: 120,168,506 T164A unknown Het
Mtrr T C 13: 68,580,555 E42G possibly damaging Het
Muc5b T A 7: 141,851,518 W888R unknown Het
Myh7 G A 14: 54,987,385 A575V probably damaging Het
Nbea A C 3: 55,983,812 L1612W possibly damaging Het
Notch3 A G 17: 32,143,242 probably null Het
Nsun4 T C 4: 116,044,810 Y153C probably damaging Het
Nup210 A G 6: 91,062,803 I690T probably benign Het
Nyap2 T A 1: 81,087,118 probably benign Het
Oaz1 T A 10: 80,826,769 S4T possibly damaging Het
Olfr1293-ps T A 2: 111,527,926 V222E Het
Olfr19 A T 16: 16,673,473 C169* probably null Het
Olfr201 T C 16: 59,269,314 M118V probably damaging Het
Olfr266 A G 3: 106,822,194 S122P probably damaging Het
Olfr813 G A 10: 129,856,589 V24M probably benign Het
Optn C T 2: 5,040,265 C222Y probably benign Het
Osmr T A 15: 6,852,552 H37L probably benign Het
Pccb G T 9: 100,995,590 P287Q probably benign Het
Pclo T A 5: 14,714,273 D4253E unknown Het
Pdcd6ip A T 9: 113,697,504 probably null Het
Pde9a T C 17: 31,459,163 probably null Het
Pdk2 C A 11: 95,039,434 V59F probably damaging Het
Pgm2 T A 4: 99,969,989 V362E probably damaging Het
Pmepa1 CCGGCGGCGGCGGCGGCGG CCGGCGGCGGCGGCGG 2: 173,276,150 probably benign Het
Pold4 T C 19: 4,232,850 F97S possibly damaging Het
Ppp5c C T 7: 17,006,961 V361I probably benign Het
Prrt1 A G 17: 34,631,146 Y178C probably damaging Het
Psmb11 A T 14: 54,625,576 I84F probably damaging Het
Smg7 A G 1: 152,861,798 S131P probably damaging Het
Snrnp200 T A 2: 127,236,508 L1728Q probably damaging Het
Stbd1 A T 5: 92,605,597 E315D probably damaging Het
Tcaf1 C T 6: 42,686,620 G109R possibly damaging Het
Thap12 C T 7: 98,707,073 R56* probably null Het
Ttn T C 2: 76,815,575 E12848G probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Uqcrfs1 G A 13: 30,541,125 A144V probably damaging Het
Usp13 T A 3: 32,901,760 probably benign Het
Wdr19 T A 5: 65,206,446 D67E possibly damaging Het
Zkscan3 A T 13: 21,394,040 W226R probably damaging Het
Zmym5 A C 14: 56,804,184 F154C probably damaging Het
Other mutations in Cpb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Cpb1 APN 3 20252029 missense probably benign 0.00
IGL01061:Cpb1 APN 3 20266516 missense probably benign 0.06
IGL01376:Cpb1 APN 3 20270324 missense probably benign 0.00
IGL01409:Cpb1 APN 3 20249805 missense possibly damaging 0.51
IGL01505:Cpb1 APN 3 20266246 missense probably damaging 1.00
IGL01599:Cpb1 APN 3 20251954 critical splice donor site probably null
IGL01672:Cpb1 APN 3 20275421 missense probably null 0.34
IGL02421:Cpb1 APN 3 20251984 missense probably damaging 1.00
IGL02685:Cpb1 APN 3 20265356 missense probably damaging 1.00
IGL02825:Cpb1 APN 3 20249725 missense probably damaging 1.00
IGL02929:Cpb1 APN 3 20275466 missense probably benign 0.00
IGL03229:Cpb1 APN 3 20249837 nonsense probably null
R0106:Cpb1 UTSW 3 20266533 splice site probably null
R0106:Cpb1 UTSW 3 20266533 splice site probably null
R0485:Cpb1 UTSW 3 20275628 missense unknown
R0609:Cpb1 UTSW 3 20262474 missense probably damaging 1.00
R0622:Cpb1 UTSW 3 20249818 missense probably damaging 1.00
R0676:Cpb1 UTSW 3 20266533 splice site probably null
R0829:Cpb1 UTSW 3 20251943 splice site probably benign
R0981:Cpb1 UTSW 3 20275490 missense probably benign 0.29
R1496:Cpb1 UTSW 3 20263532 missense probably damaging 0.99
R1535:Cpb1 UTSW 3 20266287 missense probably benign 0.19
R1607:Cpb1 UTSW 3 20263782 missense probably benign 0.03
R1707:Cpb1 UTSW 3 20275491 missense probably damaging 0.99
R1753:Cpb1 UTSW 3 20266241 missense possibly damaging 0.67
R1866:Cpb1 UTSW 3 20263756 missense probably benign 0.00
R2177:Cpb1 UTSW 3 20266447 missense probably benign 0.41
R2234:Cpb1 UTSW 3 20275465 missense probably benign 0.04
R3110:Cpb1 UTSW 3 20265357 missense probably damaging 1.00
R3112:Cpb1 UTSW 3 20265357 missense probably damaging 1.00
R4353:Cpb1 UTSW 3 20262544 missense probably benign 0.07
R4405:Cpb1 UTSW 3 20263569 missense probably benign 0.00
R4485:Cpb1 UTSW 3 20249701 missense probably benign 0.00
R4734:Cpb1 UTSW 3 20263712 missense probably benign 0.43
R4984:Cpb1 UTSW 3 20270352 frame shift probably null
R5807:Cpb1 UTSW 3 20263742 missense probably damaging 0.98
R6377:Cpb1 UTSW 3 20275584 critical splice donor site probably null
R6441:Cpb1 UTSW 3 20249814 missense probably damaging 1.00
R7175:Cpb1 UTSW 3 20263763 missense probably benign 0.00
R7488:Cpb1 UTSW 3 20270324 missense possibly damaging 0.46
R8288:Cpb1 UTSW 3 20265367 nonsense probably null
R9568:Cpb1 UTSW 3 20266533 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCATTAGTTCATCCAGTTTATCCGG -3'
(R):5'- AGTAGGTGACCGTTGGTGAC -3'

Sequencing Primer
(F):5'- TCCAGTTTATCCGGAATTTTCTTAG -3'
(R):5'- TTACTGTGGACCAACTCC -3'
Posted On 2022-03-25